Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA010601 Similarity: 0.983 Similarity: 0.982 Similarity: 0.982
UTR: 5HSAA010601
Gene: BHMT
MFE: -33.897
ENS: 0.896
Length: 102.
Predicted Ligands:
guanidine - 11/20
SAM - 9/20

 RS: URS00019AE36A_2282149
MFE: -30.107
Ligand: SAM
Species: Candidatus Roizmanbacteria bacterium SAM
 RS: URS0000D81BFF_1667172
MFE: -24.755
Ligand: SAM
Species: Staphylococcus sp. NAM3COL9 SAM riboswitch (S box leader)
 RS: URS0000AB7A16_997346
MFE: -29.616
Ligand: guanidine
Species: Desmospora sp. 8437 Guanidine-I riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA010601 URS00019AE36A_2282149 URS0000D81BFF_1667172 URS0000AB7A16_997346
Length 102. 103. 102. 103.
Similarity - 0.983 0.982 0.982
Ensemble Norm 0.896 - - -
MFE -33.897 -30.107 -24.755 -29.616
Ligands - SAM SAM guanidine
Gene BHMT - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 0.004 7.006 2.001
Length SE - 1. 0. 1.
Lev Distance - 22. 21. 23.
UBS 8. 8. 6. 7.
BS 0. 0. 0. 0.
ILL 1. 1. 0. 1.
ILR 2. 2. 1. 2.
H 3. 3. 3. 3.
BL 3. 3. 3. 2.
BR 0. 0. 1. 0.
UN 0.186 0.252 0.265 0.214

Sequences

Field Description
UTR seq + 25 agcucggggcugcgcagcgggaaggcucgccuagucgguccgcauccgugucgaccaccugucuggacaccacgaagATGCCACCCGTTGGGGGCAAAAAGG
UTR dot + 25 .((…((((((.((.(((((….)))))…))))))))))….((((((((…..)))..)))))……..((((.(((…)))))))……
RS 1 seq UAGUUAUCAAGAGUGUAGCGAGAGCACUGGCUCGAUGACCUACCGGCAACCAUCGGAAAACGAAAGGUGCCAAUUCCAGCCCCAUAUUGGGGAAAGAUAAUAA
RS 1 dot ..((((((..((((((.((….))))..))))))))))…..(((.(((.(((…..)))..))))))……..(((((…)))))………..
RS 2 seq AACUUAUCGAGAGAAGUGGAGGGACUGGCCUGUUGAUACUUCGGCAACAUGAUGAUGCGUGUGCCAAUUCCAGUAGCAUAAAUGAAUGCUAGAAGAUAAGAA
RS 2 dot ….((((((.((.(((……)))…)).))))))….(((.(((((……))))))))……..((((((……))))))………..
RS 3 seq ACGAUGGUUUUCUAGGGUUCCGCAGCGUUGCUGGACUGGUCCGAGAGAAAACACACGACUGAUGUUUCAGUUGUGCACACGGAGGGACAAAAGCCCGGGAGGA
RS 3 dot ……(((((((.(((..(((((((…))))…))))))…))))))).(((((((((….)))))))))……..(((.(….))))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table