Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA010608 Similarity: 0.982 Similarity: 0.981 Similarity: 0.980
UTR: 5HSAA010608
Gene: BHMT_0
MFE: -25.373
ENS: 0.954
Length: 84.
Predicted Ligands:
zmp-ztp - 7/20
cyclic-di-GMP - 5/20
fluoride - 3/20
 RS: URS0000C243F3_1679168
MFE: -14.183
Ligand: cyclic-di-GMP
Species: Bacillus sp. FJAT-27231 Cyclic di-GMP-II riboswitch
 RS: URS0000D98B6B_1797640
MFE: -23.860
Ligand: fluoride
Species: Chloroflexi bacterium RBG_16_48_7 Fluoride riboswitch
 RS: URS0000C7562C_1660113
MFE: -32.993
Ligand: zmp-ztp
Species: Microbacterium sp. SCN 70-200 ZMP/ZTP riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA010608 URS0000C243F3_1679168 URS0000D98B6B_1797640 URS0000C7562C_1660113
Length 84. 84. 83. 83.
Similarity - 0.982 0.981 0.980
Ensemble Norm 0.954 - - -
MFE -25.373 -14.183 -23.860 -32.993
Ligands - cyclic-di-GMP fluoride zmp-ztp
Gene BHMT - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 0.004 0.011 5.014
Length SE - 0. 1. 1.
Lev Distance - 25. 24. 24.
UBS 7. 7. 7. 6.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 1.
ILR 2. 2. 2. 1.
H 3. 3. 3. 3.
BL 1. 1. 1. 2.
BR 1. 1. 1. 2.
UN 0.179 0.119 0.072 0.060

Sequences

Field Description
UTR seq + 25 gggaaggcucgccuagucgguccgcauccgugucgaccaccugucuggacaccacgaagATGCCACCCGTTGGGGGCAAAAAGG
UTR dot + 25 .(((..((..(((…..)))..)).)))((((((((…..)))..)))))……..((((.(((…)))))))……
RS 1 seq CUUUAAAGUGGAAGCGAUGAAUAGUCAUUUGUAUGUGGGCACUUGAAUGGCUUGGAGCGAGUAGUGCAACCGACUCUUUUUUAG
RS 1 dot .((((..((….))..)))).(((((((((..((….))..))))))))).((((((.((……)))).))))…….
RS 2 seq UUUAUCUAGGGCGAUGAAGCUCGCCGAGGAAGUUCGGAACUUUCCUGAACUGCUUUGAGAAAGCUAAUAGCUUCUACCGGUAU
RS 2 dot ….(((..(((((……)))))..))).(((((((….))).))))((((…((.(((((…)))))))…)))).
RS 3 seq UCAUCUCGUCGCAACUGGCGUUGAGGUGGGUCACCACCGGGGAGCGACCAAUCGGCAAUCGACCGUUCGCCUGGGUCGAGGCC
RS 3 dot .(((((((.(((…..))).)))))))((((.((…..))…))))….(((..((((((………)))))).)))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table