Detected as a riboswitch by 14 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA010685 Similarity: 0.971 Similarity: 0.970 Similarity: 0.970
UTR: 5HSAA010685
Gene: BLVRA
MFE: -32.840
ENS: 0.887
Length: 108.
Predicted Ligands:
SAM - 7/20
TPP - 7/20
glycine - 3/20
 RS: URS0000C315B8_1700846
MFE: -23.545
Ligand: SAM
Species: Lysinibacillus sp. F5 SAM riboswitch (S box leader)
 RS: URS0000C6AB81_158787
MFE: -26.027
Ligand: TPP
Species: Bifidobacterium scardovii TPP riboswitch (THI element)
 RS: URS0000ABCCAB_411473
MFE: -22.301
Ligand: TPP
Species: Ruminococcus callidus ATCC 27760 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA010685 URS0000C315B8_1700846 URS0000C6AB81_158787 URS0000ABCCAB_411473
Length 108. 107. 108. 107.
Similarity - 0.971 0.970 0.970
Ensemble Norm 0.887 - - -
MFE -32.840 -23.545 -26.027 -22.301
Ligands - SAM TPP TPP
Gene BLVRA - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.004 3.025 4.003
Length SE - 1. 0. 1.
Lev Distance - 35. 39. 38.
UBS 9. 7. 8. 8.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 3.
ILR 3. 2. 3. 2.
H 3. 3. 4. 3.
BL 2. 1. 1. 2.
BR 1. 1. 1. 0.
UN 0.269 0.206 0.111 0.215

Sequences

Field Description
UTR seq + 25 ccgccccgguccgcaaagccgguggcgcccggaggcugcacggagagcggugcccgcgucagugaccgaaggaagagaccaagATGAATGCAGAGCCCGAGAGGAAGT
UTR dot + 25 .(((((((((…….))))).))))(((((..((((.(((..(.((…)))..)))))))..)))..))……………………((….))….
RS 1 seq UUCUUAUCGAGAGAGACGGAGGGAUUGGCCCGAUGAAGUCUCAGCAACCAGCUCAACAGUAUGGUGCUAAUUCCAAUUGGCAAAAUUUUAAGCCUGAAAGAUGAGAA
RS 1 dot (((((…..)))))…..(((((((((((.(((..((…(((…..)))..))..))))).)))))))))….(((……….)))………….
RS 2 seq AACGUAAUGCAGGGGAACCCGGCCGGUACGACGGGUUGAGAAUGGCGCAGGCCUGACCCUUAGAACCUGUUGGUUAAGACCAUCGUAGGGAGCAGCGAUAUGAACGAU
RS 2 dot ..((((..((.(((…))).))…))))((((((((((…(((….)))…..))))..)))))).(((….)))(((((……..)))))………
RS 3 seq AACAUGAUACACGGGAGCUUGCUGUGCGUGGGCUGAGAGGAGAUGCAGACAUCUCGACCGCACCUGAUUUGGAUAAUGCCAACGAAGGGAACGACACACGAUAUUUU
RS 3 dot ..((((…(((((…….))))))))).((.(.(..((((((….))))))..)))).(((…((((……))))…)))……………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table