Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA010717 Similarity: 0.965 Similarity: 0.965 Similarity: 0.961
UTR: 5HSAA010717
Gene: BMI1
MFE: -48.105
ENS: 0.798
Length: 146.
Predicted Ligands:
cobalamin - 6/20
SAM - 5/20
Ni/Co - 3/20
 RS: URS0000C5EF6F_1415775
MFE: -36.617
Ligand: SAM
Species: Clostridium baratii str. Sullivan SAM riboswitch (S box leader)
 RS: URS0000C051F1_1838280
MFE: -55.443
Ligand: SAM
Species: Desulfotomaculum copahuensis SAM riboswitch (S box leader)
 RS: URS0000AB620F_373384
MFE: -37.698
Ligand: molybdenum
Species: Shigella flexneri 5 str. 8401 Moco (molybdenum cofactor) riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA010717 URS0000C5EF6F_1415775 URS0000C051F1_1838280 URS0000AB620F_373384
Length 146. 146. 146. 146.
Similarity - 0.965 0.965 0.961
Ensemble Norm 0.798 - - -
MFE -48.105 -36.617 -55.443 -37.698
Ligands - SAM SAM molybdenum
Gene BMI1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.029 8.008 26.004
Length SE - 0. 0. 0.
Lev Distance - 44. 44. 41.
UBS 10. 9. 10. 12.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 3.
ILR 1. 0. 3. 2.
H 4. 4. 4. 2.
BL 2. 2. 2. 5.
BR 4. 2. 2. 6.
UN 0.281 0.110 0.192 0.219

Sequences

Field Description
UTR seq + 25 ugcuggcggauccccgcuccuucgacuccaacgccuucacgcuucuccuccgggcggcauuccagagucugcuggacgcccaggcggacgaggccguguuaggauuuuuuaucaagcagaaATGCATCGAACAACGAGAATCAAGA
UTR dot + 25 ….(((((….)))))……………(((.(((((((((((.(((((((….(((((……)))))))))).)).))).))))).)))..)))…………(((….))).(((…..)))………
RS 1 seq UUCUUAUCAAGAGUGGUGGAGGGACUGGCCCUAUGAAGCCCAGCAACCUGCUAAAGUAAUAGCAAGUUUUAAAUAUAUUUUUAUAUUUAAAGUGUUAUUUUAGUGUGGUGCUAAAUCCUGCAGAUUUAAUAUCUGAUAGAUAAGGG
RS 1 dot …((((((….)))))).(((.((……….)))))(((.((((((((((((((((…..(((((((((((….)))))))))))))))))))))))).))))))…..((((((((…..))))).)))…….
RS 2 seq CUCUUAUCCAGAGUGGUGGAGGGACUGGCCCGAUGAAACCCGGCAACCGCUUUCCUUCAAGGCUUUGCGGCCCCGGCGCAAAGCCCGGUACAAAGGAAGGUAUGGUGCCAAUUCCUGCAGAAGAUUUAUCUUCUGACAGAUAAGAG
RS 2 dot ……((((……))))(((…..)))……….(((.(((((((((((((..(((((((((.(…).)))))))))..)….)))))))))..))))))…..((((((((((….))))))).)))…….
RS 3 seq UUAACCACUAAACACUCUAGCCUCUGCACCUGGGUCAACUGAUACGGUGCUUUGGCCGUGACAAUGCUCGUAAAGAUUGCCACCAGGGCGAAGGAAAGAAAUGACUUCGCCUCCCGUAUCUGGAAAGGUGUACAUGGCUUCACAAC
RS 3 dot ……………(((..(((.(((.((((((.(((((..(((((.((.(((…….))).))))))).)).))).).)))))))).)))..)))………(((…..(((((….)))))…..)))……..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table