Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA010719 Similarity: 0.982 Similarity: 0.982 Similarity: 0.980
UTR: 5HSAA010719
Gene: BMI1_0
MFE: -29.244
ENS: 0.955
Length: 109.
Predicted Ligands:
TPP - 18/20
Mg2+ - 2/20

 RS: URS0000C0D2E5_1237896
MFE: -25.672
Ligand: TPP
Species: Colletotrichum gloeosporioides Cg-14 TPP riboswitch (THI element)
 RS: URS0000AB2028_2653177
MFE: -28.072
Ligand: TPP
Species: Bacillus sp. 9J TPP
 RS: URS0000D9A8A9_1793963
MFE: -35.416
Ligand: TPP
Species: Bacillus nakamurai TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA010719 URS0000C0D2E5_1237896 URS0000AB2028_2653177 URS0000D9A8A9_1793963
Length 109. 109. 110. 109.
Similarity - 0.982 0.982 0.980
Ensemble Norm 0.955 - - -
MFE -29.244 -25.672 -28.072 -35.416
Ligands - TPP TPP TPP
Gene BMI1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.016 2.016 2.014
Length SE - 0. 1. 0.
Lev Distance - 23. 23. 26.
UBS 7. 6. 6. 6.
BS 0. 0. 0. 0.
ILL 1. 0. 0. 1.
ILR 1. 1. 1. 1.
H 3. 3. 3. 3.
BL 2. 2. 2. 1.
BR 2. 2. 2. 2.
UN 0.183 0.312 0.309 0.303

Sequences

Field Description
UTR seq + 25 ccgagaggaguacugguauuuccagccucggcggcucucccggccgcagcgcccuuuguugagaggauuuuuuaucaagcagaaATGCATCGAACAACGAGAATCAAGA
UTR dot + 25 ….((((….((((…..)))))))).((((((…..))))))…….(((((((.(((.((((((……..)))))).).))…)))))))……..
RS 1 seq AAAAGUGACUAGGGGUGCUCGUAAAUGGGCUGAGAGAGAAGCAUAAGCUUCUUAACCCUUUGGACCUGAUCUGGCUCGUACCAGCGUGGGGAAGUUGAAGAUGAUGCAU
RS 1 dot …………….((((……))))…..(((((((….)))))))….((((((.(((.((((((……)))).)).)))…))))))………
RS 2 seq AUAAGUGACUAGGGGUGCCCGGAAAUGCGGGCUGAGAGAGAAGACAAGCUUCUUAACCCUUUGGACCUGAUCUGGCUCGUACCAGCGUGGGGAAGUUGAAGAUGAUACAU
RS 2 dot …………….(((((……)))))…..((((((…..))))))….((((((.(((.((((((……)))).)).)))…))))))………
RS 3 seq AAUAGUUACUGGGGGUGCCCGUUGGCGGGCUGAGAGAGAAGCGGAUGCUUCUUAACCCUUUGGACCUGAUCUGGUUCGUACCAGCGUGGGGAAGUAGAGGUUUUAUUAU
RS 3 dot …………….(((((….)))))…..(((((((….)))))))…((((((..(((.(((((((….))))).)).)))…))))))………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table