Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA010720 Similarity: 0.972 Similarity: 0.971 Similarity: 0.967
UTR: 5HSAA010720
Gene: BMI1_1
MFE: -45.414
ENS: 0.988
Length: 127.
Predicted Ligands:
TPP - 9/20
cobalamin - 5/20
glycine - 2/20
 RS: URS0002325834_1777139
MFE: -42.460
Ligand: cobalamin
Species: Caballeronia calidae Cobalamin riboswitch
 RS: URS0002328FE9_1304903
MFE: -32.017
Ligand: cobalamin
Species: Alteromonadaceae bacterium Bs31 Cobalamin riboswitch
 RS: URS0000D8C4C7_1797950
MFE: -44.917
Ligand: FMN
Species: Elusimicrobia bacterium RIFCSPLOWO2_02_FULL_61_11 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA010720 URS0002325834_1777139 URS0002328FE9_1304903 URS0000D8C4C7_1797950
Length 127. 127. 127. 127.
Similarity - 0.972 0.971 0.967
Ensemble Norm 0.988 - - -
MFE -45.414 -42.460 -32.017 -44.917
Ligands - cobalamin cobalamin FMN
Gene BMI1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 12.004 6. 12.
Length SE - 0. 0. 0.
Lev Distance - 32. 36. 39.
UBS 9. 10. 8. 10.
BS 0. 0. 0. 0.
ILL 3. 3. 3. 3.
ILR 2. 3. 2. 3.
H 2. 2. 2. 3.
BL 1. 4. 2. 1.
BR 5. 4. 3. 2.
UN 0.173 0.110 0.157 0.181

Sequences

Field Description
UTR seq + 25 ccgccccgcacgcccgccgaggcucggggcucgggccgggcuccgcgcggaguugcagcgguggccggaugccaaguguaagugauuuuuuaucaagcagaaATGCATCGAACAACGAGAATCAAGA
UTR dot + 25 ..(((((((..((((((((.(((((((……..))))))).)).)))).))….)))).)))..(((((….(((…((((…..)))).)))…..)))))………………
RS 1 seq AUAGAAUGGCAAGCUUGCAGUGCGAGGAAGCCGGUGCAAAUCCGGCACGGUCGCGCCACUGUAUGCGGUUCGUGAGCUUAAAGGCGCUCUGCCGCGAGUCAGACCCCGCUGCAUGCUCUUCAUCAAU
RS 1 dot …((((.(((….(((((((((.((..(((((…….)))))….)).))).))))))))).))))..((((…..((((.((((.(….).))))…))))….))))………
RS 2 seq UGAUUGCACUAUAUGUUGUGUUCGGGUCACUUGAAUGCAGGGGAACCUGGUGUGAAUCCAGGGCUGUCGCGCAACGGUAUGUGACUUGGUCAUAAGCCCGAUUACCUGCUCAAACUGUCACCUUAAA
RS 2 dot .((((((((((..(.(((((((((((…))))))))))).)…..)))))).))))((((…((((……(((.((((((…)))))).)))))))..))))……………….
RS 3 seq UAAGUUCUUCAGGGCGGGGCGAGAUUCCCCACCGGCGGUAACCCGAAAGGGAAGCCCGCAAGCCCGCAAGGGCAGACCCGGUUAAAUUCCGGGGCCGACGGUAAAGUCCGGAUGAAAGAAGAACGCG
RS 3 dot …((((((..(((((((((….(((((…(((.(….))))…))))))))).)..))))..))))))…(((((…….))))).(((((……))).))…………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table