Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA010777 Similarity: 0.950 Similarity: 0.945 Similarity: 0.943
UTR: 5HSAA010777
Gene: BMPR1B
MFE: -54.123
ENS: 0.797
Length: 195.
Predicted Ligands:
cobalamin - 18/20
lysine - 2/20

 RS: URS000233290C_1262872
MFE: -39.255
Ligand: cobalamin
Species: Dorea sp. CAG:105 Cobalamin riboswitch
 RS: URS00023215BB_1797835
MFE: -84.150
Ligand: cobalamin
Species: Deltaproteobacteria bacterium RBG_13_65_10 Cobalamin riboswitch
 RS: URS000231E026_1105367
MFE: -83.047
Ligand: cobalamin
Species: Rhodobacter sp. DW2-9 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA010777 URS000233290C_1262872 URS00023215BB_1797835 URS000231E026_1105367
Length 195. 196. 195. 193.
Similarity - 0.950 0.945 0.943
Ensemble Norm 0.797 - - -
MFE -54.123 -39.255 -84.150 -83.047
Ligands - cobalamin cobalamin cobalamin
Gene BMPR1B - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 18.001 5.001 14.005
Length SE - 1. 0. 4.
Lev Distance - 60. 73. 67.
UBS 4. 6. 5. 6.
BS 9. 6. 9. 11.
ILL 0. 2. 0. 2.
ILR 2. 3. 1. 2.
H 2. 2. 3. 2.
BL 3. 3. 4. 4.
BR 2. 2. 3. 3.
UN 0.241 0.265 0.215 0.171

Sequences

Field Description
UTR seq + 25 gcuaaugaggagggcugccugcuggguaagaauguuguugguggcagagccguuuuguguacugcuguugagaaugccggguacauucacaagacguuuccugcgugugguaggaacagcucucaagcaccaauuucauauuguguccuaucacaaacuuccuugauaacATGGGTTGGCTGGAAGAACTAAACT
UTR dot + 25 (((((((((((((..((..((.((((..(.(((((.(((((((..((((((((((((((((((((……….))..)))))….)))))))).(((((((…..)))))))..)))))….)))))))…))))).)..)))).))))..)))))))……….))))))……………
RS 1 seq UACAGAAGCCCGAACAGAUUUUGCAGUGGCUUAUUAUAUUUUUCAAGGAACAUGCGGUGAGAUUCCGCCACAGACUUUAUCCCUACUGUAAUCAGGACGAAAGCGUCAGAUCCAUUGAGAACGAGAGGUUCUUGAGAAGGGACGUGAGUAGGUUGGAACUGCGAGACAGGAUACAGGUAUCUGGAGAUCAUAAAAG
RS 1 dot ..((((.(((……..(((((((((((((((((.(((((((((((((…((.((((……)))).))………(((..(((..((((((((….))))…….))))..)))..)))))))))))))…..)))))))))))…)))))))))………))).))))………….
RS 2 seq CUUCAUCCUAACCGGCCGGGUGCAGGGAAGAUCGUGAAAGUCGAUCGCUGCCCCGCAACUGUGAGUCCGACGAAAACCGCAGGCGCGCCGCGAGGGACGCGGCGUGCGGCCACUGCCGCCCCGCGCGGGUGGUGGAAAGGCGCGGUGAGUAGGACGACGACGAGCCAGGAAACCUGCUCGGCCGGCACGCGACCU
RS 2 dot ………..((((((((..(((((…..((.((…((((.((((((((((((..(((((.((………)))))))((((((((((…..)))))))))).(((.(((((((((…..)))))))))…))))))).).))))..)))))))….)).))..)))))))))))))……….
RS 3 seq CAAGACACAUCACGCCUUGGUUCCGGCUUGGCCGGAUGAAACGGGAACGCGGUGCGCCUUCGGGCCAUGCCGCGACUGCCCCCGCAACUGUAAGCGGCGAGCGACGGCGCACUGGCCACUGGGCAUCCCCCGGGAAGGCGCGCCCGAGCCACGACCCGCAAGUCAGGAGACCGGCCCGGGCGUCACCCAUGUC
RS 3 dot …((((….((((((.((..((((((((((..(.((…((((..((.(((((((((((.((((((((((((..((((…((……..))))))..)).)))))…))))).(((((…..))))))))))))))))))..)).))…)))..))))))…)))))).))))))……))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table