Detected as a riboswitch by 12 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA010788 Similarity: 0.987 Similarity: 0.985 Similarity: 0.985
UTR: 5HSAA010788
Gene: BMS1
MFE: -20.498
ENS: 0.874
Length: 78.
Predicted Ligands:
SAM - 12/20
cobalamin - 3/20
GMP - 3/20
 RS: URS0000DB477A_1317121
MFE: -19.349
Ligand: SAM
Species: Aestuariivita atlantica SAM riboswitch (alpha-proteobacteria)
 RS: URS0000D911D1_1470563
MFE: -17.539
Ligand: SAM
Species: Pseudopelagicola gijangensis SAM riboswitch (alpha-proteobacteria)
 RS: URS0000B464BB_475083
MFE: -16.754
Ligand: SAM
Species: Roseovarius aestuarii SAM riboswitch (alpha-proteobacteria)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA010788 URS0000DB477A_1317121 URS0000D911D1_1470563 URS0000B464BB_475083
Length 78. 78. 78. 79.
Similarity - 0.987 0.985 0.985
Ensemble Norm 0.874 - - -
MFE -20.498 -19.349 -17.539 -16.754
Ligands - SAM SAM SAM
Gene BMS1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2. 4.003 12.002
Length SE - 0. 0. 1.
Lev Distance - 17. 19. 16.
UBS 4. 4. 5. 6.
BS 0. 0. 0. 0.
ILL 1. 2. 2. 2.
ILR 1. 1. 1. 2.
H 3. 2. 2. 2.
BL 0. 0. 1. 2.
BR 0. 0. 0. 1.
UN 0.167 0.179 0.115 0.127

Sequences

Field Description
UTR seq + 25 ggagucgcggcugcgagcagguuagaguuacuuguuauugguaaauagccacuATGGAGGCTAAGGACCAGAAGAAAC
UTR dot + 25 …..(((….)))(((((((…….))))))).(((((…(((((……..)))))…)))))…….
RS 1 seq UCAGAAACCCGUGGCGAUUUGUUACCGGAUUGCGGGCCACGUUAAACAUGCCGCUAAAGAGGUCAGGACGUGAAAGCC
RS 1 dot …….(((…((((((((….))))))))))).((((((……(((……..)))…))))))……
RS 2 seq ACAAUGCCCAGUGGCGAUUUGUUACCGGAUUGCGGGCCACUUUAAAUAAACCGCUAAAGAGGUCAGGACGAAGGAACC
RS 2 dot …..((((….((((((((….))))))))))))(.((((……(((……..)))……)))))….
RS 3 seq AAGAACCCACGUGGCGAUUUGUUACCGGAUUGCGGGCCACGUUAAACAUCACCGCUAAAGAGGUCAGACGGAGGAACUC
RS 3 dot …..(((…..((((((((….)))))))))))((.((((..((.((………)).))..))))..))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table