Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA010809 Similarity: 0.975 Similarity: 0.974 Similarity: 0.974
UTR: 5HSAA010809
Gene: BNIP2
MFE: -47.901
ENS: 0.965
Length: 119.
Predicted Ligands:
molybdenum - 10/20
SAM - 6/20
glycine - 2/20
 RS: URS0000AB61E9_370438
MFE: -44.744
Ligand: molybdenum
Species: Pelotomaculum thermopropionicum SI Moco (molybdenum cofactor) riboswitch
 RS: URS0000C71538_1629716
MFE: -32.384
Ligand: molybdenum
Species: Peptococcaceae bacterium BRH_c4a Moco (molybdenum cofactor) riboswitch
 RS: URS0000D99FD9_1797291
MFE: -34.234
Ligand: molybdenum
Species: Candidatus Atribacteria bacterium RBG_19FT_COMBO_35_14 Moco (molybdenum cofactor) riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA010809 URS0000AB61E9_370438 URS0000C71538_1629716 URS0000D99FD9_1797291
Length 119. 119. 119. 120.
Similarity - 0.975 0.974 0.974
Ensemble Norm 0.965 - - -
MFE -47.901 -44.744 -32.384 -34.234
Ligands - molybdenum molybdenum molybdenum
Gene BNIP2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10. 3.006 3.008
Length SE - 0. 0. 1.
Lev Distance - 30. 34. 33.
UBS 9. 9. 8. 8.
BS 0. 0. 0. 0.
ILL 2. 0. 2. 1.
ILR 1. 2. 2. 1.
H 3. 3. 3. 3.
BL 3. 4. 3. 3.
BR 3. 1. 2. 2.
UN 0.126 0.109 0.202 0.217

Sequences

Field Description
UTR seq + 25 agucgacgcgacggguccgcccacaggcaaggaaggccgaccccgcgagugcaggcgcgagcgcuagcccgugacgucugaggggguuggggggATGGAACCTTGCCCCTCCTCCGCTC
UTR dot + 25 ……((((..(((((.(((………….))).)))))))))….((((((((.((….)).))…)))))).(((((..(((((.(……..).))))))))))….
RS 1 seq AUACAAUUUAUUCUCCGAGCUUGGCAUGCCUAAGCAAGGUACGGCAGCCAAGCCGUUAGGGUACGGGCGGGAAACCCCCGUGCCUCCCGGUGCGGAAAGGAGAAGGCGGCUGUUUGGAA
RS 1 dot …………((.((.(((((((.((((…………)))))))))))))..))((((((((.((….))))))))))(((((((((…………))).)))…))).
RS 2 seq UAAUAACCGAGUCUCCGAGUCUACCUGCCUAAAGCUCUUGUCAUGGCAGACUGACCGACAGGGUAUGCCGGGAAACUGGUAUGCCUCCCAUAGCGGAAAGGAGAGAUGUGUUUUGAAAA
RS 2 dot ……………((.(((…(((((….((….))…)))))…)))))…(((((((((((….)))))))))))..((.((((.(………).)))).))….
RS 3 seq UAAAAAAAUAUUCUCCGAGCUAUCACACCUAAGGUAGAAACUAUGGUGGAUUAGCCGAUAAGGAAUGAGAGGAAACUCUUAUUCCUCCCGUGUUUGGAAAGGAGGCUUGAUAUGAUGAGU
RS 3 dot ……………((.((((((.((((..((…….))..))))))).)))))…(((((((((((….)))))))))))..((((((.((……..)).))))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table