Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA010948 Similarity: 0.978 Similarity: 0.976 Similarity: 0.976
UTR: 5HSAA010948
Gene: BRD1
MFE: -37.437
ENS: 0.918
Length: 107.
Predicted Ligands:
TPP - 19/20
homocysteine - 1/20

 RS: URS0000BEE637_645517
MFE: -44.281
Ligand: TPP
Species: Altererythrobacter namhicola TPP riboswitch (THI element)
 RS: URS0000BF3C2D_1392836
MFE: -18.636
Ligand: TPP
Species: Lachnospiraceae bacterium TWA4 TPP riboswitch (THI element)
 RS: URS0000DB37FF_1739315
MFE: -19.073
Ligand: TPP
Species: Globicatella sp. HMSC072A10 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA010948 URS0000BEE637_645517 URS0000BF3C2D_1392836 URS0000DB37FF_1739315
Length 107. 108. 107. 107.
Similarity - 0.978 0.976 0.976
Ensemble Norm 0.918 - - -
MFE -37.437 -44.281 -18.636 -19.073
Ligands - TPP TPP TPP
Gene BRD1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4. 8.007 11.015
Length SE - 1. 0. 0.
Lev Distance - 27. 29. 28.
UBS 7. 7. 8. 7.
BS 2. 2. 0. 0.
ILL 3. 2. 4. 2.
ILR 2. 1. 3. 3.
H 2. 2. 2. 2.
BL 2. 3. 2. 3.
BR 4. 3. 3. 2.
UN 0.150 0.130 0.234 0.271

Sequences

Field Description
UTR seq + 25 aguccgagccagccccgcgucccgcgcccgcccgcuugccgggcucccgcggccgcggcgccccgaagguaaucauuaccaaATGAGGAGGAAAGGACGATGTCATC
UTR dot + 25 .((((…((.((.(((((..(((((…(((((…..)))))…))))).))))).))((((..(((((…)))))…)).)).))…))))………
RS 1 seq CUGCCAUCCCCGGGGAGCGCGCUUGCGCUGAGAGGUGGGCGUAGCGCCCCACGACCCGUCGAACCUGAACCGAUUAGCAUCGGCGGAGGGAGUGGGCGGUCGCUGAUG
RS 1 dot (((((.(((((((((.((((…((((((.(….).))))))))))))).))..(((((((..((((…..))))..))))))).))))…)))))………
RS 2 seq UAUAGUUUAUAGGGGAGCUGAUUAAAUUGGCUGAGAGGAAAUUGUAAAUUUCGACCCUUUAACCUGAUGCGGAUAAUGCCGCCGUAGGAAAUCAUAAGUUAUUUCGA
RS 2 dot ……(((.((((..(..((((.((((..((….)).))))…)))).)..)))).)))((((..((((……))))..))))……………….
RS 3 seq AUUUUAAACUAGGGGAGCCAAUGCGCUGAGAGUAGGUUUCUGAAAUGUUCCUUGACCCUUGACCUGAUGUAGUUAGUACUACCGUAGGGAUGUUUACAAUUUUGUUU
RS 3 dot ………((((((…(((.(((.(.((((…..)))).)..)))…))).)))))).((((..(((((….)))))..))))……………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table