Detected as a riboswitch by 10 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA011095 Similarity: 0.957 Similarity: 0.954 Similarity: 0.953
UTR: 5HSAA011095
Gene: BRSK1
MFE: -43.573
ENS: 0.865
Length: 152.
Predicted Ligands:
TPP - 7/20
FMN - 5/20
cobalamin - 4/20
 RS: URS0000C62D9A_1232866
MFE: -51.756
Ligand: cobalamin
Species: Caballeronia udeis AdoCbl riboswitch
 RS: URS0000C10D0E_1705602
MFE: -63.404
Ligand: zmp-ztp
Species: Acidovorax sp. 12322-1 ZMP/ZTP riboswitch
 RS: URS0000D918D9_2020130
MFE: -48.767
Ligand: FMN
Species: Arthrobacter sp. 7749 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA011095 URS0000C62D9A_1232866 URS0000C10D0E_1705602 URS0000D918D9_2020130
Length 152. 151. 152. 151.
Similarity - 0.957 0.954 0.953
Ensemble Norm 0.865 - - -
MFE -43.573 -51.756 -63.404 -48.767
Ligands - cobalamin zmp-ztp FMN
Gene BRSK1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.002 10.001 18.001
Length SE - 1. 0. 1.
Lev Distance - 54. 58. 54.
UBS 8. 9. 10. 10.
BS 2. 0. 0. 0.
ILL 2. 2. 2. 4.
ILR 4. 4. 4. 4.
H 3. 2. 2. 1.
BL 3. 2. 3. 2.
BR 2. 2. 3. 3.
UN 0.059 0.099 0.092 0.026

Sequences

Field Description
UTR seq + 25 gcucacgccuguaaucccagcacuuugggaagcugaggugggcaaaucacaaggucaggaguuugagaccagccugaccaacauggugaaaccccaucucuacuaaaaauacaaaaauuagccaggcATGTCGTCCGGGGCCAAGGAGGGAG
UTR dot + 25 …((.(((((…((((((….)))))).(((((((((((….((((..(((((((.(((…)))…)))))))……))))…))))))))……………….)))))))).))((.(((……..))).))..
RS 1 seq GAAGUAAAAUGCGCGCUUACGACCCGUGGAAGCUGGUGCAAAUCCAGCACGGUCGCGCCACUGUGACCGGUUGCAGCGCAAACCGGAAGUCAGACCUCGGCGUCGUAUACCUCUUUCUGACAUUGGGGCGCGCACUCCCCGGGAGACAUUC
RS 1 dot ………(((((((((((((((((.((…(((((((…..((((.(((((((……)))))))))))….))..)))))……..)).))).))))))……………….))))))))((((…))))……
RS 2 seq UACAGGGUACGCAACUGGCGAUAGGUGCAGCAGUUUUUCCACUGCCUUGCACUGACGUGGAAUCGCUGCAGGGCCUGUCAGCCCUGCCAACCACCGGGGAGCGUACCGCCCAGUCUGUUCGGGCGUUUCAGCCGUUCGCCUGGGCAGCCCUU
RS 2 dot …..(((((((..((((((((((((.(.(((((..(((((((((…)))…..))))))..))))).).))))))).)))………….))..)))))))…..(.(((((((((((………..))))))))))))….
RS 3 seq CAACGUGCUCCGGGGUCGGUGUAAGUCCGAACCGGCGGUUAUAGUCCGCGACCCAUGCCAAAGAGGCUUCUCACAAGAAGCCUUCGCCGCUUGGUUGAACUGGUGAAAUUCCGGUACCGACAGUUAAAGUCUGGAUGGGAGAAGCACGUAC
RS 3 dot ..((((((((((((((((((……….(((((…(((((((…((((.((.((….(((((((((….)))))))))….)).)))))).)))).)))….)))))))))))……..))))))……..))))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table