Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA011292 Similarity: 0.983 Similarity: 0.983 Similarity: 0.983
UTR: 5HSAA011292
Gene: BTF3
MFE: -10.314
ENS: 0.923
Length: 83.
Predicted Ligands:
cyclic-di-GMP - 10/20
GMP - 8/20
cobalamin - 1/20
 RS: URS0000D996CC_1121302
MFE: -10.716
Ligand: cyclic-di-GMP
Species: Clostridium cavendishii DSM 21758 Cyclic di-GMP-II riboswitch
 RS: URS0000D6BB9A_12908
MFE: -15.204
Ligand: GMP
Species: unclassified sequences c-di-GMP-II-AAU riboswitch
 RS: URS0000D6A274_12908
MFE: -31.527
Ligand: GMP
Species: unclassified sequences c-di-GMP-II-GAG riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA011292 URS0000D996CC_1121302 URS0000D6BB9A_12908 URS0000D6A274_12908
Length 83. 83. 84. 84.
Similarity - 0.983 0.983 0.983
Ensemble Norm 0.923 - - -
MFE -10.314 -10.716 -15.204 -31.527
Ligands - cyclic-di-GMP GMP GMP
Gene BTF3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.005 4.004 7.005
Length SE - 0. 1. 1.
Lev Distance - 21. 21. 20.
UBS 6. 5. 5. 7.
BS 0. 0. 0. 0.
ILL 0. 1. 1. 1.
ILR 1. 1. 1. 0.
H 2. 2. 2. 2.
BL 3. 1. 2. 3.
BR 2. 1. 1. 4.
UN 0.193 0.265 0.131 0.119

Sequences

Field Description
UTR seq + 25 uuuuaaagagacuggucagcauugcuaauuuaaauuuuucuuuucuuaauaggugaauATGCGACGGACAGGCGCACCCGCTC
UTR dot + 25 …………(.(((.((((((((.(((……………..))).)))))…)))))).)…((((….)))).
RS 1 seq UGAAAUUUUGGAAGUUAUGAUGCUUGUUCUUUAUUUGGUCACUUUAGACAAGCGGAGCUAAUAGUGAACCCACUCCAAUUACU
RS 1 dot ………….(((((..((((((.(((……………)))))))))..).))))((((….))))………
RS 2 seq UAUGAUACGAGAGCUUUGAGAUAUAACUUAUAAUUUGGUCACCUGAGUUAUAUGGAGCUAGUGGUGAAACCUCCUUCAAUAAGG
RS 2 dot …..(((.(.((((((…((((((((((………….))))))))))))))))..).)))……((((….))))
RS 3 seq ACGUGAGCGGGAGGCUCUGACACGCGGCCCAUACACCGGUCGCCGGGACCGCGCCGAGCCACUGGCGAGACCGACCCGCCUCGG
RS 3 dot ……((.((.(((((.(…((((((((…………..))).)))))).))))).)).))….((((……))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table