Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA011301 Similarity: 0.980 Similarity: 0.979 Similarity: 0.978
UTR: 5HSAA011301
Gene: BTG2
MFE: -28.246
ENS: 0.974
Length: 96.
Predicted Ligands:
TPP - 10/20
glycine - 2/20
SAM - 2/20
 RS: URS0000ABC98F_66692
MFE: -31.882
Ligand: guanidine
Species: Bacillus clausii KSM-K16 Guanidine-I riboswitch
 RS: URS0000D80EDD_1802007
MFE: -28.207
Ligand: cobalamin
Species: Pseudomonadales bacterium RIFCSPLOWO2_02_FULL_63_210 Cobalamin riboswitch
 RS: URS0000AB283E_743525
MFE: -36.142
Ligand: TPP
Species: Thermus scotoductus SA-01 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA011301 URS0000ABC98F_66692 URS0000D80EDD_1802007 URS0000AB283E_743525
Length 96. 97. 96. 95.
Similarity - 0.980 0.979 0.978
Ensemble Norm 0.974 - - -
MFE -28.246 -31.882 -28.207 -36.142
Ligands - guanidine cobalamin TPP
Gene BTG2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 4.002 3.002
Length SE - 1. 0. 1.
Lev Distance - 23. 27. 27.
UBS 8. 7. 9. 8.
BS 0. 0. 0. 0.
ILL 2. 3. 2. 3.
ILR 3. 3. 2. 2.
H 2. 2. 2. 2.
BL 4. 2. 5. 3.
BR 2. 1. 1. 2.
UN 0.125 0.103 0.083 0.084

Sequences

Field Description
UTR seq + 25 caggguaacgcugucuuguggacccgcacuucccacccgagaccucucacugagcccgagccgcgcgcgacATGAGCCACGGGAAGGGAACCGACA
UTR dot + 25 ..((((..(((……))).))))….(((((.((((……((((.((.((.((…..)).))..))))))…))))..)))))……
RS 1 seq CACAAAUGCGCCUAGGGUUCCGCUUCAUUUGUAAGGGCUGGUCCGAGAGGUGCACACGGCGUCUGCCGUGACACGGAGGGAUAAAAGCCCGGGAGAC
RS 1 dot .(((((((.((…((…))))..)))))))..(((((.((((…..(((..((((((….)))))).)))….))))…)))))…….
RS 2 seq AGCUCGUGAACAGGUCCCGGUGUCCGAGGGGUGAAACAGGGAAGUCGGUGCGUUGUGCGUGUUCACGCCAACAAUUCCGACGCUGCCCCCGCAACG
RS 2 dot ..((((.(.(((……..))))))))(((…….((.(.(((((…((((.((((….))))))))….)))))..).)))))……
RS 3 seq GGGCGUCACCGGGGGUGCCCUCUUAUGGGGCUGAGAGAUACCCUUGGAACCUGAUCCGGGUAAUGCCGGCGUAGGGAAGGUGACCAAGGCCCCUC
RS 3 dot (((((((……)))))))……((((((..(.(.((((.((….((((..((((……))))..)))))).)))).))..))))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table