Detected as a riboswitch by 12 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA011302 Similarity: 0.966 Similarity: 0.964 Similarity: 0.963
UTR: 5HSAA011302
Gene: BTG2_0
MFE: -52.750
ENS: 0.892
Length: 141.
Predicted Ligands:
FMN - 11/20
cobalamin - 4/20
SAM - 2/20
 RS: URS0000C77C09_2026
MFE: -67.137
Ligand: FMN
Species: Thermoactinomyces vulgaris FMN riboswitch (RFN element)
 RS: URS0000DB15E1_1986608
MFE: -36.170
Ligand: SAM
Species: Muricauda sp. TMED12 SAM riboswitch (S box leader)
 RS: URS0000C3B8C3_1679168
MFE: -43.222
Ligand: FMN
Species: Bacillus sp. FJAT-27231 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA011302 URS0000C77C09_2026 URS0000DB15E1_1986608 URS0000C3B8C3_1679168
Length 141. 142. 141. 142.
Similarity - 0.966 0.964 0.963
Ensemble Norm 0.892 - - -
MFE -52.750 -67.137 -36.170 -43.222
Ligands - FMN SAM FMN
Gene BTG2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2. 4.003 6.001
Length SE - 1. 0. 1.
Lev Distance - 44. 46. 45.
UBS 12. 12. 12. 12.
BS 0. 0. 0. 2.
ILL 2. 2. 3. 2.
ILR 3. 3. 4. 3.
H 3. 4. 3. 3.
BL 5. 4. 4. 6.
BR 5. 5. 4. 6.
UN 0.078 0.063 0.135 0.042

Sequences

Field Description
UTR seq + 25 aaaaacgcugcccggggaaaguccgggcagagcccgagcagcggccaggguaacgcugucuuguggacccgcacuucccacccgagaccucucacugagcccgagccgcgcgcgacATGAGCCACGGGAAGGGAACCGACA
UTR dot + 25 …..(.(((((((((…..))))))))).)(((((((((((……….))))).)))).))…((…(((((.((((……((((.((.((.((…..)).))..))))))…))))..))))).))…
RS 1 seq GCGCGUCAGCGGGGUCGGUGAAAUUCCGAGCCGGCGGUGAGCGGCGACAGCCGCGAGUCCGCGACCCGUCCGCAUCCAGCGGACGGUUGACCUGGUGAGAAUCCAGGACCGACGGUCAAAGUCCGGAUGGGAGCAGACGCAA
RS 1 dot .(((….)))((.((((…….)))).)).(((((..(((((….)))))..).))))….((((.((.((((.(((((..((((((((((………..))))..)))))).)))))..)))).)).))))…
RS 2 seq GUGUUAUCAAGAAAGGUGGAGGGAUUGGACCCUGUGAAGCCUUAGCAACCCUCGACUUCGAGAAGGUGCUACAUUCUACCCUUGUCUUGAACUGGUUUCGAGACCUUUGGGAACUUUAAUCUGUAAGGGGAAGGAUAACGU
RS 2 dot ………….(((((.((((……)))).)…))))((((.(((((((….))))..))))))).(((((.(((((..(..((…((((((.((….)).))))))….)).)..))))).)))))…..
RS 3 seq GUAAUCCUUCGGGGCGGGGUGAAAUUCCCCACCGGCGGUGAUGAGCAGAGGCUCUUAGUCCGUGACCCGCGUUCGUUUUGAGGCGGUGGAUUCGGUGAAAUUCCGAAGCCGACAGUGACAGUCUGGAUGGGAGAAGGAUCAC
RS 3 dot ((.(((((((..((.((((…….)))).)).(((((((.((((….)))))))..))))…((.((((((..(((..((.((((.(((((…….))))).)).)).))..)))..)))))))).))))))).))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table