Detected as a riboswitch by 14 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA011303 Similarity: 0.966 Similarity: 0.966 Similarity: 0.964
UTR: 5HSAA011303
Gene: BTG2_1
MFE: -52.750
ENS: 0.904
Length: 143.
Predicted Ligands:
FMN - 12/20
cobalamin - 4/20
SAM - 3/20
RS: URS000232AC11_1262950
MFE: -31.499
Ligand: cobalamin
Species: Ruminococcus sp. CAG:108 Cobalamin riboswitch
RS: URS0000C77C09_2026
MFE: -67.137
Ligand: FMN
Species: Thermoactinomyces vulgaris FMN riboswitch (RFN element)
RS: URS0000C482EB_12908
MFE: -28.599
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA011303 URS000232AC11_1262950 URS0000C77C09_2026 URS0000C482EB_12908
Length 143. 144. 142. 143.
Similarity - 0.966 0.966 0.964
Ensemble Norm 0.904 - - -
MFE -52.750 -31.499 -67.137 -28.599
Ligands - cobalamin FMN glutamine
Gene BTG2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 2.001 6.008
Length SE - 1. 1. 0.
Lev Distance - 43. 44. 45.
UBS 12. 11. 12. 11.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 2.
ILR 3. 2. 3. 3.
H 3. 3. 4. 3.
BL 5. 4. 4. 4.
BR 5. 5. 5. 3.
UN 0.091 0.118 0.063 0.182

Sequences

Field Description
UTR seq + 25 ugaaaaacgcugcccggggaaaguccgggcagagcccgagcagcggccaggguaacgcugucuuguggacccgcacuucccacccgagaccucucacugagcccgagccgcgcgcgacATGAGCCACGGGAAGGGAACCGACA
UTR dot + 25 …….(.(((((((((…..))))))))).)(((((((((((……….))))).)))).))…((…(((((.((((……((((.((.((.((…..)).))..))))))…))))..))))).))…
RS 1 seq UGUAUAUAACUUAAUAUGGGUUUACGGUUCAAAAUGCAUCUUGCAGAGUAGAUAACAGAGAAUUCGGUGAGAAUCCGAAGCAACAGUCAUUACUGUAUUUGGCAUUGCCAUAAGUCAGGUCGCUGUCCGUAUGCCUCGGAUUUU
RS 1 dot ……………(((.((((……..)))).)))(((((.((((…………)))).)))))(((((((.((((((((.((..(((..((((((…)))).))..))))).)))))…..))).)))))))..
RS 2 seq GCGCGUCAGCGGGGUCGGUGAAAUUCCGAGCCGGCGGUGAGCGGCGACAGCCGCGAGUCCGCGACCCGUCCGCAUCCAGCGGACGGUUGACCUGGUGAGAAUCCAGGACCGACGGUCAAAGUCCGGAUGGGAGCAGACGCAA
RS 2 dot .(((….)))((.((((…….)))).)).(((((..(((((….)))))..).))))….((((.((.((((.(((((..((((((((((………..))))..)))))).)))))..)))).)).))))…
RS 3 seq AACGUUCAUCUUAUUUUUAUAAUAAGACGGAAGUAGGAAGAUAGGAAAACCUCUUUCUUUUUCAAAGAAAGGCAAGCAAGUACCGCUUAGGUUUAAUUAUCAUAGGCGGGAACGAGACCGAAUAUCUGCCGAAGGAACGCGUU
RS 3 dot ……(.(((((((…..))))))).)((((.(((((((..((….))))))))).))))…….(((.(((..((.((((((((((……))).)))))))..))..)………)))))………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table