Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA011520 Similarity: 0.984 Similarity: 0.978 Similarity: 0.978
UTR: 5HSAA011520
Gene: BZW1
MFE: -22.222
ENS: 0.958
Length: 102.
Predicted Ligands:
purine - 8/20
TPP - 6/20
glycine - 6/20
RS: URS0000D9ED25_1194090
MFE: -26.738
Ligand: TPP
Species: Aliifodinibius roseus TPP riboswitch (THI element)
RS: URS0000D78610_393763
MFE: -13.890
Ligand: purine
Species: Anaerobacillus alkalilacustre Purine riboswitch
RS: URS0000833FD3_1462524
MFE: -13.644
Ligand: purine
Species: Paraliobacillus sp. PM-2 Purine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA011520 URS0000D9ED25_1194090 URS0000D78610_393763 URS0000833FD3_1462524
Length 102. 101. 102. 101.
Similarity - 0.984 0.978 0.978
Ensemble Norm 0.958 - - -
MFE -22.222 -26.738 -13.890 -13.644
Ligands - TPP purine purine
Gene BZW1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 8.051 11.008
Length SE - 1. 0. 1.
Lev Distance - 19. 27. 25.
UBS 4. 5. 5. 6.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 2. 3. 0. 1.
H 1. 1. 2. 2.
BL 2. 1. 3. 4.
BR 1. 1. 2. 2.
UN 0.245 0.238 0.471 0.337

Sequences

Field Description
UTR seq + 25 aggagacaccgccgcaguugccgguacaucggggauuucuggcucuuuccucuucgccuuaaauucgggugucuuuuATGAATAATCAAAAGCAGCAAAAGC
UTR dot + 25 ((((((((((((((.((((.(((……))).))))..))))……………………))))))))))…………………….
RS 1 seq GCCAGCGGUUGGGGGUGUCCCAAACAAGAGUUGGGACUGAGAUCAGACCCCUCGAACUUGAUCCGGACCAUGCCGGCGAAAGGAAACCAACGGCUUCAUUA
RS 1 dot (((.(((((((((((((((((((…….)))))))………))))))………….))))..)).)))……………………
RS 2 seq AAAAGAAUACGUGAUUUUCCUCAUAUAAUAUUGGGAAUAUGGCCCAGAAGUUUCUACCUAAUGACCGUAAAUCAUUGGACUAUGAAGGAAAGCAAUAUACUU
RS 2 dot ……….((.((.((((.((……..)))))).)).))…………..(((((((…….)))))))……………………
RS 3 seq AUAAUUUUAUAGGUAAUUCGUCGUAUAAUCUUGAGAAUAGGGCUCUAGAGUUUCUACUGACCACCGUAAAUGGUCUGGCUACGAAGAAGAAUAAUUACUAU
RS 3 dot ..(((((((.((.(.((((.(((……..)))))))..).)).)))))))……(((((…….)))))……………………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table