Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA011521 Similarity: 0.962 Similarity: 0.961 Similarity: 0.961
UTR: 5HSAA011521
Gene: BZW1_0
MFE: -20.724
ENS: 0.906
Length: 139.
Predicted Ligands:
FMN - 12/20
cobalamin - 5/20
TPP - 3/20
 RS: URS0000DAA435_561061
MFE: -37.189
Ligand: TPP
Species: Sphingobacterium sp. MOL-1 TPP riboswitch (THI element)
 RS: URS0000C39988_1050174
MFE: -38.191
Ligand: TPP
Species: Corynebacterium sp. DSM 45586 TPP riboswitch (THI element)
 RS: URS0000DA5A33_1965627
MFE: -40.344
Ligand: FMN
Species: Lachnoclostridium sp. An298 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA011521 URS0000DAA435_561061 URS0000C39988_1050174 URS0000DA5A33_1965627
Length 139. 137. 139. 138.
Similarity - 0.962 0.961 0.961
Ensemble Norm 0.906 - - -
MFE -20.724 -37.189 -38.191 -40.344
Ligands - TPP TPP FMN
Gene BZW1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 14.007 14. 13.007
Length SE - 4. 0. 1.
Lev Distance - 42. 48. 47.
UBS 5. 7. 7. 8.
BS 0. 0. 0. 0.
ILL 1. 1. 2. 1.
ILR 0. 3. 2. 1.
H 4. 3. 3. 5.
BL 0. 0. 2. 1.
BR 1. 1. 1. 2.
UN 0.353 0.270 0.367 0.268

Sequences

Field Description
UTR seq + 25 agaaagaaaagguaucaguacagaaaagaagagucagaaaauaccgugcaaaggcacauucagaacguaaccaggauagcuggagccaggauucaaggagagagggugucuuuuATGAATAATCAAAAGCAGCAAAAGC
UTR dot + 25 ……….(((((…………………….)))))((((….))))………….((((…..))))…….(((((..((((((…..)))))).)))))……………….
RS 1 seq AAAAUACUUAUGGGGUGCUCUCGUUCAGCAAUUUUUUAGCUGAAACGAUAGAGGCUGAGAAUAUACCCAAUCUUGCGGUAACGUAAGAGGAACCUGAUCCAGGUAAUGCUGGCGUAGGGAUAAAUUUUCUUUUUUUA
RS 1 dot …………(((((((((((((((((………)))))).)))..)))……….)))))..(((((((….)))))))….((((..((((……))))..))))……………….
RS 2 seq AGAAAUUCACACGGGUGCUGCAAAGCAAUUGCCCUUCCAAGGACAGUUGCGGUGCGGCUGAGAUGUCUCGAACCAGACGAGCAAACCGUAACAAACUGACCCGGGUAAUGCCGGCGUAGUGAGGAAGAAAUACAUGACU
RS 2 dot …………….((((((..(((((((.(((….))).)))))))..))))))…..((.((((…….))))))………..((((..((((……))))..))))……………….
RS 3 seq UAAAAUCUUCGGGGUCGGGUGUAAUUCCCAACCGGCGGUAUAGUCCGCGAACUGCUUUUGAGAGCAGCCGAACCGGUGACUUUCUGAUAAGAAGGAAUUCCGGUACCGACAGUACAGUCUGGAUGAGAGAAGAGAUUU
RS 3 dot …………(((.(((…….))).))).((((……))))…((((((….))))))….(((((…((((((….))))))….))))).(((((……))).))…………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table