Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA013475 Similarity: 0.983 Similarity: 0.981 Similarity: 0.981
UTR: 5HSAA013475
Gene: C1D
MFE: -22.354
ENS: 0.987
Length: 88.
Predicted Ligands:
TPP - 10/20
cobalamin - 4/20
zmp-ztp - 2/20
 RS: URS0000C70A7B_35841
MFE: -19.165
Ligand: TPP
Species: Bacillus thermoamylovorans TPP riboswitch (THI element)
 RS: URS0000C406AD_1609095
MFE: -45.682
Ligand: cobalamin
Species: Streptomyces sp. NRRL F-4489 Cobalamin riboswitch
 RS: URS0000C3CC62_883077
MFE: -17.951
Ligand: TPP
Species: Actinomyces turicensis ACS-279-V-Col4 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA013475 URS0000C70A7B_35841 URS0000C406AD_1609095 URS0000C3CC62_883077
Length 88. 89. 88. 89.
Similarity - 0.983 0.981 0.981
Ensemble Norm 0.987 - - -
MFE -22.354 -19.165 -45.682 -17.951
Ligands - TPP cobalamin TPP
Gene C1D - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.012 3.001 0.001
Length SE - 1. 0. 1.
Lev Distance - 20. 25. 25.
UBS 7. 6. 6. 7.
BS 0. 0. 0. 0.
ILL 2. 1. 2. 2.
ILR 3. 2. 3. 3.
H 2. 2. 2. 2.
BL 2. 1. 1. 2.
BR 2. 2. 1. 2.
UN 0.136 0.247 0.159 0.101

Sequences

Field Description
UTR seq + 25 gcccgaccgcuuuccgggagacuggagucgaaggccgugagguauuuuucuaagucagccauaATGGCAGGTGAAGAAATTAATGAAG
UTR dot + 25 (((..((.(((((((((….))))))…..))).))..)))…(((((..(((.((((…)))).)))..)))))………
RS 1 seq AAACUCUACUAGGGGCGCCGGUUGGCUGAGAAGUACCCUUUGAACCUGAUCUAGUUCGUACUAGCGGAGGGAAGUAGGUUAAUAAAUUA
RS 1 dot ……….(((((((((….)))……)).))))…((((((.(((..(((((….))))).)))..))))))………
RS 2 seq GGGGAAGUCCGGUGAGAGUCCGGCGCUGACCCGCAACGGUAAGCGGAACGGCCCCGCCCGGGGCCGCGCUCCGCGAGCCCGAUCGCCC
RS 2 dot (((..(((((((…….)))).)))..)))…..(((..(((((.(((((((….)))))))…)))))..)))………
RS 3 seq UGGCGUGACACGGGGUGCCACAGGCUGAGAAAAAACCCGUUGAACCUGUCGAGAUAAUUCUGACGAAGGGAAUGUCAAUGAUGGAUCGU
RS 3 dot ….((..((..(((((((…)))………))))..)).))((((((.((((.((((……)))).))))..))))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table