Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA013478 Similarity: 0.957 Similarity: 0.957 Similarity: 0.956
UTR: 5HSAA013478
Gene: C1D_0
MFE: -45.829
ENS: 0.877
Length: 164.
Predicted Ligands:
FMN - 10/20
TPP - 4/20
molybdenum - 2/20
 RS: URS0000C53B70_1262877
MFE: -37.842
Ligand: FMN
Species: Eggerthella sp. CAG:368 FMN riboswitch (RFN element)
 RS: URS0000D8181D_28028
MFE: -52.968
Ligand: TPP
Species: Corynebacterium flavescens TPP riboswitch (THI element)
 RS: URS0000C4B19D_169760
MFE: -50.523
Ligand: FMN
Species: Paenibacillus stellifer FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA013478 URS0000C53B70_1262877 URS0000D8181D_28028 URS0000C4B19D_169760
Length 164. 165. 164. 165.
Similarity - 0.957 0.957 0.956
Ensemble Norm 0.877 - - -
MFE -45.829 -37.842 -52.968 -50.523
Ligands - FMN TPP FMN
Gene C1D - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.011 6.002 8.006
Length SE - 1. 0. 1.
Lev Distance - 54. 55. 54.
UBS 12. 12. 11. 13.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 1.
ILR 3. 1. 3. 1.
H 5. 5. 4. 5.
BL 4. 4. 4. 5.
BR 4. 5. 2. 5.
UN 0.268 0.164 0.220 0.194

Sequences

Field Description
UTR seq + 25 cuggagucgaaggccgugaggucgucaucguugcccgaccgcuuuccgggagaccaguguuuuagaaggaguauguggaagggcaaggaguaccuauagaaccccggaggagggugaggagcagagcuggucagccauaATGGCAGGTGAAGAAATTAATGAAG
UTR dot + 25 ……..((.((((….)))).)).((.((((((..((((.((((..(((((….)))))….))))…))))..)))))).))………..(((((….).))))…((.((….)).)).((((…))))………………..
RS 1 seq UACGAUCUUCAGGGCGAGGUGGAAUUCCUCACUGGCGGUAUCGGUUUUGUGAAUGAAUAGCUGUAGUUCAUGCAAACUUGAAGCCCGCGACCCUCUUUGAGUAAAGAGGCUGAUUUGGUUAAAGGCCAAAGCCAACGGUUAUAGUCCGGAUGAAAGAAGAUGCAA
RS 1 dot ………(((…((((…….)))).)))(((((.((((.(((((..((((((…….))))))))))).)))).))).))…(((((((….)))))))..(.(((((((…))))))).)((.(((…….)))..))………….
RS 2 seq AACACUGAACACGGGUGCUCUCGUGUGGGGUAGGUUACGUGCCCGGCUUGUGCCGUCUUCUGACUUGCUCCCUCCAGGAGGGCUGAGAUGUGUCGCAAGCGCGCACAAACCGUUGAACCUGAUCCGGGUAAUUCCGGCGAGAGGAAGAAUUAAGCAUGACUAGU
RS 2 dot .((.(((….)))))((((((.((.(((((((((((……((((….))))…..)))))))).)))..)).))))))…..((((.(((….)))))))……….(((…(((((….)))))….)))………………..
RS 3 seq AUAAUCCUUCAGGGCAGGGUGAAAUUCCCUACCGGCGGUGAUGAAACAGAUGACGCAUCAGCGUAGCUAGUUUCUCAGUCCGCUACCCGGACCGCAAUCAAUGCGGACGGUGGACCUGGUGCAAUUCCGGGACCGACAGUAUAGUCUGGAUGGAAGAAGGAGAGU
RS 3 dot …………((.((((…….)))).))((((((((.(((((((.(.((((….)))).))).))))))))..)))))..(((..(((((…..))))).)))(((.(((((…….))))).))).(((……)))……………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table