Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA013479 Similarity: 0.980 Similarity: 0.980 Similarity: 0.979
UTR: 5HSAA013479
Gene: C1D_1
MFE: -26.396
ENS: 0.970
Length: 100.
Predicted Ligands:
TPP - 8/20
purine - 6/20
zmp-ztp - 2/20
 RS: URS0000C620FD_1581033
MFE: -9.433
Ligand: purine
Species: Bacillus sp. FJAT-21945 Purine riboswitch
 RS: URS0000C63CAF_1514105
MFE: -11.631
Ligand: purine
Species: Erysipelothrix larvae Purine riboswitch
 RS: URS0000527639_561276
MFE: -17.126
Ligand: TPP
Species: Streptococcus pneumoniae ATCC 700669 Thiamine pyrophosphate riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA013479 URS0000C620FD_1581033 URS0000C63CAF_1514105 URS0000527639_561276
Length 100. 100. 100. 99.
Similarity - 0.980 0.980 0.979
Ensemble Norm 0.970 - - -
MFE -26.396 -9.433 -11.631 -17.126
Ligands - purine purine TPP
Gene C1D - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11.012 4. 5.001
Length SE - 0. 0. 1.
Lev Distance - 23. 26. 25.
UBS 8. 6. 7. 7.
BS 0. 0. 0. 0.
ILL 4. 2. 3. 5.
ILR 2. 1. 2. 3.
H 1. 1. 1. 1.
BL 2. 3. 3. 1.
BR 3. 2. 4. 2.
UN 0. 0.310 0.210 0.172

Sequences

Field Description
UTR seq + 25 agagccggcgcgucauugucgucaucguugcccgaccgcuuuccgggagacuggagucgaaggccgugagccauaATGGCAGGTGAAGAAATTAATGAAG
UTR dot + 25 …..((.(..((((((((.((..(((..(((((((…..(((((….)))))))))..)))..))))).)))))))).).))……………
RS 1 seq AUUAUUCGUAUUUUUGUUCUCUGUAUAAAGUUGGAGAUAUGGUCCAAAAGUUUCUACCAAACUACUGUAAAUAGCCUUAGACGGGAUAUUUUUAUAUUAA
RS 1 dot ……………..((.((((.(((.((((….((((((…..(((((…..)))))))))))..)))).))).))))))…………..
RS 2 seq UUUUUUAAAAUCAUUAUAUUUUGUAUAAUCGUGAAAUGUUGGUUCACAAGUCUCUACCUUGCUCCGUUCGUGCAAGACUACAAAAUAGAAUACUUCUUUU
RS 2 dot …………(((.(((((((((…((.((..(((.(((….((((…….))))..)))..))).)).)).))))))))).)))………
RS 3 seq AACAACCACUAGGGGUGCGUAAAGCUGAGAUUAACGACUGUUAGAUCCCUCUGACUCAAUCUAGAUAAUGCUAGCUGAUGGAAGUGGAAAUGAUAAUGG
RS 3 dot …..(((((…..(.(((..(((((..((((..((..((((((….))))))….))….))))..))))).))).))))))…………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table