Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA013480 Similarity: 0.987 Similarity: 0.986 Similarity: 0.986
UTR: 5HSAA013480
Gene: C1D_2
MFE: -18.536
ENS: 0.964
Length: 75.
Predicted Ligands:
fluoride - 15/20
glycine - 3/20
SAM - 1/20
 RS: URS0000C33D1D_1262755
MFE: -14.185
Ligand: fluoride
Species: Blautia sp. CAG:237 Fluoride riboswitch
 RS: URS00023173D0_240015
MFE: -25.632
Ligand: fluoride
Species: Acidobacterium capsulatum ATCC 51196 Fluoride riboswitch
 RS: URS0000C21395_1263031
MFE: -12.910
Ligand: fluoride
Species: Firmicutes bacterium CAG:56 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA013480 URS0000C33D1D_1262755 URS00023173D0_240015 URS0000C21395_1263031
Length 75. 74. 74. 76.
Similarity - 0.987 0.986 0.986
Ensemble Norm 0.964 - - -
MFE -18.536 -14.185 -25.632 -12.910
Ligands - fluoride fluoride fluoride
Gene C1D - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.001 1.006 2.013
Length SE - 1. 1. 1.
Lev Distance - 16. 17. 17.
UBS 4. 3. 4. 3.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 1.
ILR 1. 0. 1. 0.
H 2. 2. 2. 2.
BL 0. 0. 1. 0.
BR 0. 0. 0. 0.
UN 0.387 0.419 0.311 0.

Sequences

Field Description
UTR seq + 25 gcccgaccgcuuuccgggagacuggagucgaaggccgugagucagccauaATGGCAGGTGAAGAAATTAATGAAG
UTR dot + 25 (((((((…..(((((….)))))))))..)))………((((…))))………………..
RS 1 seq ACCCGAAUUGGGAAUGAAGUUCUCCCAUGGGAAACCUAAACUGCUUAUUCAGAGCUGAUGACUUCUACGAUUAU
RS 1 dot .((((…(((((………)))))))))………..((((…..))))……………….
RS 2 seq GGAGAUACGGGCGGUGGAGUUCGCCUCAGUCCCAACCGUUGCCGGUCCCGGCAGCCAAUGACUCCUGACACUUU
RS 2 dot ((.(((..((((((……))))))..)))))….(((((((….)))))))……………….
RS 3 seq AUGACUGCCGGGAAUGAGGUUCUCCCUGGUUUUUAACCAAACCGCUUGUAUAUAAGCUGAUGACUUCUGCGAUUUC
RS 3 dot ……((((((…(((…)))))))))………….(((((….)))))……………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table