Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA013481 Similarity: 0.983 Similarity: 0.983 Similarity: 0.983
UTR: 5HSAA013481
Gene: C1D_3
MFE: -18.086
ENS: 0.985
Length: 76.
Predicted Ligands:
fluoride - 8/20
cobalamin - 7/20
SAM - 2/20
 RS: URS0000C02CA0_410291
MFE: -12.838
Ligand: fluoride
Species: Vibrio harveyi HY01 Fluoride riboswitch
 RS: URS0000D8FE6D_398199
MFE: -13.624
Ligand: fluoride
Species: Clostridium sp. D3RC-2 Fluoride riboswitch
 RS: URS0000BE515F_1736336
MFE: -25.021
Ligand: SAM
Species: Aureimonas sp. Leaf324 SAM riboswitch (alpha-proteobacteria)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA013481 URS0000C02CA0_410291 URS0000D8FE6D_398199 URS0000BE515F_1736336
Length 76. 76. 76. 76.
Similarity - 0.983 0.983 0.983
Ensemble Norm 0.985 - - -
MFE -18.086 -12.838 -13.624 -25.021
Ligands - fluoride fluoride SAM
Gene C1D - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.025 3.034 5.008
Length SE - 0. 0. 0.
Lev Distance - 22. 22. 22.
UBS 4. 4. 3. 5.
BS 0. 0. 0. 0.
ILL 1. 0. 0. 1.
ILR 1. 0. 0. 2.
H 3. 3. 3. 2.
BL 0. 1. 0. 1.
BR 0. 0. 0. 1.
UN 0.263 0.421 0.447 0.171

Sequences

Field Description
UTR seq + 25 gcuuuccgggagacuggagucgaaggccgugagguauuuuucuaagccauaATGGCAGGTGAAGAAATTAATGAAG
UTR dot + 25 …((((((….))))))……(((….))).((((((…((((…))))….))))))……….
RS 1 seq AAUGCACACGGUGAUGGGGUGCCACCAGAAUCGAAAGAUUCAAACCGCUUUUACAGCUGAUGACUCCUACAGAAAC
RS 1 dot …((((.(……..)))))…..(((((….)))))…..(((…..)))……………….
RS 2 seq UAGACUUCUGGAAAUGAAGUGCUUCCAUGGCAAAAACUGCCAAAACCGCAAGUAUGCUGAUGACUUCUACGACGAA
RS 2 dot …(((((…….)))))…….(((((…..)))))…..(((….)))……………….
RS 3 seq CGCCGCGUUCGUGGUGAUUUGCCGGCCGGCUUGCAGCCACGUAAAACAAGUCGCUAAAGGCCGUUUCGCCUCACCC
RS 3 dot ((((((….))))))…….(((((((((..(((.((………)).)))..))))))….)))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table