Detected as a riboswitch by 6 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA014991 Similarity: 0.988 Similarity: 0.988 Similarity: 0.987
UTR: 5HSAA014991
Gene: C5
MFE: -11.516
ENS: 0.840
Length: 55.
Predicted Ligands:
glutamine - 20/20 - 20/20


 RS: URS0000C5B89C_12908
MFE: -10.401
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
 RS: URS0000C851F0_12908
MFE: -11.588
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
 RS: URS0000C73083_12908
MFE: -10.822
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA014991 URS0000C5B89C_12908 URS0000C851F0_12908 URS0000C73083_12908
Length 55. 55. 56. 55.
Similarity - 0.988 0.988 0.987
Ensemble Norm 0.840 - - -
MFE -11.516 -10.401 -11.588 -10.822
Ligands - glutamine glutamine glutamine
Gene C5 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.008 3.007 12.003
Length SE - 0. 1. 0.
Lev Distance - 15. 15. 14.
UBS 2. 3. 3. 4.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 0. 0. 0. 0.
H 2. 2. 2. 2.
BL 0. 1. 1. 2.
BR 0. 1. 1. 2.
UN 0.291 0.382 0.375 0.236

Sequences

Field Description
UTR seq + 25 uauauccgugguuuccugcuaccuccaaccATGGGCCTTTTGGGAATACTTTGTT
UTR dot + 25 ….(((((((((………….)))))))))((….))…………
RS 1 seq AUCGUUCAUCUUCUUAUAUGAAGACGGAAGUAGACGGAAGUCGAAGGAACGCAUG
RS 1 dot ….(((.(((((……))))).)))….(((….)))………….
RS 2 seq AUCGUUCAAUCCUUGUUUAAGAGGAUCGGAAGUAGGGCAACCCAAAGGAACGCGGA
RS 2 dot ….(((.((((((……)))))).)))….(((…)))………….
RS 3 seq UACGUUCAUCGCCUUAAAAAGCGACGGAAGUAGACGAAAGUCGAAGGAACGCAUG
RS 3 dot (((.(((.((((……..)))).))).)))(((….)))………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table