Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA015952 Similarity: 0.963 Similarity: 0.962 Similarity: 0.959
UTR: 5HSAA015952
Gene: CA5B
MFE: -38.560
ENS: 0.903
Length: 142.
Predicted Ligands:
TPP - 8/20
cobalamin - 7/20
SAM - 3/20
 RS: URS000231B853_351607
MFE: -59.516
Ligand: cobalamin
Species: Acidothermus cellulolyticus 11B Cobalamin riboswitch
 RS: URS0000C4B02C_383855
MFE: -46.119
Ligand: TPP
Species: Pseudocercospora fijiensis CIRAD86 TPP riboswitch (THI element)
 RS: URS0000AB668B_1055526
MFE: -46.872
Ligand: TPP
Species: Candidatus Burkholderia kirkii UZHbot1 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA015952 URS000231B853_351607 URS0000C4B02C_383855 URS0000AB668B_1055526
Length 142. 144. 140. 142.
Similarity - 0.963 0.962 0.959
Ensemble Norm 0.903 - - -
MFE -38.560 -59.516 -46.119 -46.872
Ligands - cobalamin TPP TPP
Gene CA5B - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.002 5.001 7.
Length SE - 4. 4. 0.
Lev Distance - 42. 43. 50.
UBS 14. 15. 14. 14.
BS 0. 0. 0. 0.
ILL 4. 4. 4. 5.
ILR 5. 4. 5. 3.
H 3. 3. 3. 2.
BL 6. 6. 4. 6.
BR 4. 5. 5. 5.
UN 0.042 0.083 0.071 0.049

Sequences

Field Description
UTR seq + 25 gugcaggcugcggauccccguaggcgagcgagcggcuagguucgugaucuggagagacgcucagauuauuaaguuccugcaacuuaacugggaacugaucaagauuucaagcuaaagATGGTGGTGATGAACAGCCTGAGGG
UTR dot + 25 ..((.(.((((((….)))))).)..))(((..((.(((..((((((((((……..)))))))))…)..)))))..)))..((.((..(((.(((…..(((.((((….))))..)))))).))).)).))..
RS 1 seq GCGUGAUUUGCUCAACGCGGCAACACCUUCAUACGCGCCCGAACGUGCAGGGGAAGCCGGUCAAAGUCCGGCGCUGACCCGCAACCGUAGGCCGCGGCGCUGUCCGCGGCGAGCCGGAGUACCUGCCGGGCGCGGAGAGGCUCC
RS 1 dot ..(((..(((((……))))))))…….((((.((..((((((.(((..((((((…….)))))..)..))))))..))).)).))))((.((.((((((.(..((.((….)).))..).)))))).))))…
RS 2 seq GUGCAGCACUGCGGGCGCCGAGUGCAAAGCUCUGCAACUUCUGCAAAGCAGAGGCUUGACAGACUGUUGCACGAAGCUGAGAAGGACCGCUAUGACUCGAUCAAGAUAAUGCUUGCGUGAGAAAGUGCUGCCGCUUCUGC
RS 2 dot …..(((((.(((…))))))))..(((((((((((.((((..((((….))))..))))..)))))).)).))).((((((.(.((..(..((((..((((……))))..))))..)..)).).).)))))..
RS 3 seq CUGCUAACAUGGGGGUUCUGCGUUGCACAUCGCGGUUUCGUCGGCUUCGUGAGACUGGAUCGCCUCGUGUGGCGUGGGUGAGAAAUACCCUUUGAACCUGAUCUGGAUAAUGCCAGCGCAGGGAAGCGUUCGGGCCCGGCGG
RS 3 dot ..(((.(((((((((.((((.(((.(((…((.(……).))…))).))))))).).))))))))))).(((((..((…((.((((…((((..((((……))))..)))))))).))))..)))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table