Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA015956 Similarity: 0.958 Similarity: 0.957 Similarity: 0.955
UTR: 5HSAA015956
Gene: CA5B_0
MFE: -47.133
ENS: 0.912
Length: 161.
Predicted Ligands:
cobalamin - 11/20
FMN - 4/20
Mg2+ - 3/20
 RS: URS000232427E_1160719
MFE: -62.228
Ligand: cobalamin
Species: Cutibacterium granulosum DSM 20700 Cobalamin riboswitch
 RS: URS0002324FCC_1284675
MFE: -32.317
Ligand: cobalamin
Species: Cycloclasticus sp. symbiont of Bathymodiolus heckerae Cobalamin riboswitch
 RS: URS000231F9B2_76728
MFE: -57.057
Ligand: cobalamin
Species: Streptomyces vitaminophilus Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA015956 URS000232427E_1160719 URS0002324FCC_1284675 URS000231F9B2_76728
Length 161. 160. 159. 161.
Similarity - 0.958 0.957 0.955
Ensemble Norm 0.912 - - -
MFE -47.133 -62.228 -32.317 -57.057
Ligands - cobalamin cobalamin cobalamin
Gene CA5B - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6. 10.003 14.012
Length SE - 1. 4. 0.
Lev Distance - 51. 46. 51.
UBS 15. 14. 13. 14.
BS 0. 0. 0. 0.
ILL 5. 5. 4. 7.
ILR 6. 4. 5. 4.
H 2. 2. 2. 2.
BL 6. 5. 4. 4.
BR 6. 6. 6. 5.
UN 0.031 0.019 0.082 0.143

Sequences

Field Description
UTR seq + 25 guagcuucgauggccggacgugcaggcugcggauccccguaggcgagcgagcggcuagguucgugaucuggagagacgcucagauuauuaaguuccugcaacuuaacugggaacugaucaagauuucaagcuaaagATGGTGGTGATGAACAGCCTGAGGG
UTR dot + 25 (((((((..(((……)))..)))))))…..(((.((((((..((.((.((((((((.(.(((((.((..(…(((((….(((((((…..))))))))))))…)..)).))))).).))))…..)))).))..))..).))))).)))
RS 1 seq GUCCCACCCGCUAUGCUCGGUACGAGCGGUCGAAGUGGGAGGAAGUCGGUGUGAGUCCGGCGCGGUCCCGCCACUGUGAACCGGCACAUUGUCGAUCUGCCCCGUAGAUCGACACACUGAACGGUGCAGCCAGAUACUCCGUCGAUCGCAGCGCACAUCA
RS 1 dot .((((((.((((..(((((…))))))).))..)))))).((.((((.(((((…(((((.(((…….((((..((((.((…(((((((((((…)))))))))))…))..))))))))……))).))))).))))).)).)).)).
RS 2 seq AGAAUCAAGAAACGUAUUGGUUCCUUUGUAGGUUAAUUGGGAAGUAUGGUUCGCUUUUUGUUUAUUAAUGAAACGUUAUUCCAUCGCUGCCACCGCAACGGUAAUGAAAAAUAGUGGUAUUUUUUAAGCCCGGAGACCAGCCAAUACCCUUCAGUUAUU
RS 2 dot .(((((((……..)))))))……….((((((((..((((((((.(((((..(((((..((((..(((((.(((.((((.(((….))).))))…))).))).))..))))…)))))..)))).).))))).)))..))))))))..
RS 3 seq GAAGCGGAACACCAGUACAGUGGCCCUGACAAGUUCACACGUUCAUCCGUGCCCCAGCAGGAGAAGCCGGUGGGAUUCCGGCACUGACCCGCAACCGUGUACCGGCGCCGCAGCCGCGUCAGCCGGGCAGUCGGAACGCCUGCUGGGACACGAGCGGCUUU
RS 3 dot …..((..(((…….)))..))………….(((((….(((.(((((((((.(…((((..(…((((((..(((((.((..(.((((….)))).)..)).).)))))))))))..))))..).))))))))).))))))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table