Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA015961 Similarity: 0.970 Similarity: 0.970 Similarity: 0.967
UTR: 5HSAA015961
Gene: CA7
MFE: -58.876
ENS: 0.992
Length: 134.
Predicted Ligands:
FMN - 7/20
SAM - 6/20
molybdenum - 2/20
 RS: URS0000AB24D5_290339
MFE: -38.134
Ligand: molybdenum
Species: Cronobacter sakazakii ATCC BAA-894 Moco (molybdenum cofactor) riboswitch
 RS: URS0000C480C4_1112204
MFE: -51.715
Ligand: glycine
Species: Gordonia polyisoprenivorans VH2 Glycine riboswitch
 RS: URS0000C510A1_1655574
MFE: -41.288
Ligand: FMN
Species: Microbacteriaceae bacterium BACL25 MAG-120322-bin65 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA015961 URS0000AB24D5_290339 URS0000C480C4_1112204 URS0000C510A1_1655574
Length 134. 136. 133. 134.
Similarity - 0.970 0.970 0.967
Ensemble Norm 0.992 - - -
MFE -58.876 -38.134 -51.715 -41.288
Ligands - molybdenum glycine FMN
Gene CA7 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.002 3. 7.009
Length SE - 4. 1. 0.
Lev Distance - 34. 38. 42.
UBS 10. 9. 11. 9.
BS 0. 0. 0. 0.
ILL 3. 4. 3. 1.
ILR 3. 3. 3. 2.
H 4. 3. 4. 4.
BL 2. 2. 3. 2.
BR 1. 1. 2. 2.
UN 0.082 0.125 0.098 0.179

Sequences

Field Description
UTR seq + 25 ccgcugcuuuaagaggcugcuccgcgguagcgagcggggccggagccgcagcccgaacgagcggaccgagccgaccgggcaggugcacggcugcggggacggcagcggcATGTCCCTCAGCATCACCAACAATG
UTR dot + 25 .(((((((….(((….)))…))))))).((((……..)))).(((((..((.((…….))))..))))).((((….((((.(((((((((….)).)))))))))))..))))…….
RS 1 seq ACCUGAAAAUGACACUCAAGCCUUUGCGCCUACGUUUUUAAGAAAUAUGGUGCUCUGGCCGUGGCGAAACGCCACCAGGGUGCAGGAAGAAAUGACUGCAUCUCCCGAUUUGGAAAGGUGUACAUGGCUUCUCAAC
RS 1 dot …((((((((…(.(((….))).)….))))))))………(((((((((…(((((…)))))))))))))).(((((..(((..(((((((.((…..))..))))))))))..)))))….
RS 2 seq CGGCGUCUCUGGAAAGUGACGAGCCACUCGUCCGCCCACGGUGAAAGGCCAGACGCGUCGGUGACGCCGCGUACGGCCGAAUCUCUCAGGCGCCGGCCGGAUCCGCGAUCCGCGGCAUGACAGAGGGGGAGGA
RS 2 dot .((((((.((….)).)))..)))..(((.(((….))))))..((((..(((((.((….)).)))))..))))…((((((….((((..((((((…))))))))))……))))))…..
RS 3 seq UAACGUGCUCCGGGGUCAGUGAAAAUCUGAGCCGGCGGUGAUAGUCCGCGACCCGACUGCAACGAGAGUUGUUGGCGGUUGAUUGGGUGAAAUUCCUGAACCGACGGUUAAAGUCCGGAUGGUAGGAGGCGUAC
RS 3 dot …………((.((((…….)))).)).((((…….)))).(((((((((((((((…)))))).)))))….))))….(((((..((((.(((…….)))..)))))))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table