Detected as a riboswitch by 9 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA016038 Similarity: 0.991 Similarity: 0.990 Similarity: 0.989
UTR: 5HSAA016038
Gene: CACNA1B
MFE: -11.727
ENS: 0.856
Length: 54.
Predicted Ligands:
glutamine - 13/20
unknown - 6/20
homocysteine - 1/20
 RS: URS0000E6070B_1801832
MFE: -17.270
Ligand: unknown
Species: Omnitrophica bacterium RIFCSPLOWO2_12_FULL_44_17 nhaA-I RNA
 RS: URS000080E144_305
MFE: -18.538
Ligand: homocysteine
Species: S-ADENOSYLHOMOCYSTEINE RIBOSWITCH from Ralstonia solanacearum (PDB 3NPQ, chain B)
 RS: URS0000C582C6_12908
MFE: -8.866
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA016038 URS0000E6070B_1801832 URS000080E144_305 URS0000C582C6_12908
Length 54. 54. 54. 54.
Similarity - 0.991 0.990 0.989
Ensemble Norm 0.856 - - -
MFE -11.727 -17.270 -18.538 -8.866
Ligands - unknown homocysteine glutamine
Gene CACNA1B - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 1. 2.005 1.
Length SE - 0. 0. 0.
Lev Distance - 12. 13. 15.
UBS 5. 5. 5. 5.
BS 0. 0. 0. 0.
ILL 1. 0. 1. 0.
ILR 1. 1. 0. 1.
H 1. 1. 1. 1.
BL 3. 3. 2. 3.
BR 3. 3. 3. 3.
UN 0.148 0.148 0.222 0.148

Sequences

Field Description
UTR seq + 25 ucuaugaugcacccuaugaguacgagcugATGGTCCGCTTCGGGGACGAGCTGG
UTR dot + 25 (((.(((.((…((((.(((….))).))))…)).))).)))……..
RS 1 seq GGGUCCGGGCGAAUAGUUCCCGGAGGUGCUUUUUUGAUGGUCGGGCCGCCAUCU
RS 1 dot .(((((((.((((.(((.((….)).))).)))….).)))))))…….
RS 2 seq GGACGAGGAGCGCUGCAAGCGAGAGCCCAGGCUCGUCCGUUCAAACGGCGCUCA
RS 2 dot ((((((.((((.(((…((….)).))))))).)).))))…………
RS 3 seq AUCGUUCAACUUCAUUACGAAGUCGGAAGUAAGCGAAAGCUGAAGGAACGCAAC
RS 3 dot .((.((((.((((.((((……….))))..))).).)))).))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table