Detected as a riboswitch by 14 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA016201 Similarity: 0.983 Similarity: 0.982 Similarity: 0.981
UTR: 5HSAA016201
Gene: CALCOCO1
MFE: -20.150
ENS: 0.886
Length: 81.
Predicted Ligands:
cobalamin - 5/20
SAM - 4/20
homocysteine - 3/20
 RS: URS0000D86DE5_1255656
MFE: -26.537
Ligand: Mg2+
Species: Agrococcus casei LMG 22410 Glycine riboswitch
 RS: URS0000C6AD74_135947
MFE: -34.246
Ligand: homocysteine
Species: Actinoplanes awajinensis subsp. mycoplanecinus S-adenosyl-L-homocysteine riboswitch
 RS: URS0000D816A6_1839801
MFE: -28.866
Ligand: zmp-ztp
Species: Dehalogenimonas formicexedens ZMP/ZTP riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA016201 URS0000D86DE5_1255656 URS0000C6AD74_135947 URS0000D816A6_1839801
Length 81. 81. 80. 81.
Similarity - 0.983 0.982 0.981
Ensemble Norm 0.886 - - -
MFE -20.150 -26.537 -34.246 -28.866
Ligands - Mg2+ homocysteine zmp-ztp
Gene CALCOCO1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 7. 10.001
Length SE - 0. 1. 0.
Lev Distance - 22. 21. 22.
UBS 7. 7. 6. 7.
BS 0. 0. 0. 0.
ILL 4. 5. 3. 3.
ILR 4. 3. 2. 3.
H 1. 1. 1. 1.
BL 0. 0. 1. 2.
BR 1. 2. 1. 3.
UN 0.062 0.049 0.050 0.086

Sequences

Field Description
UTR seq + 25 aaggugaggggaacagcugauccgucuguugggaggacagauaucucaaggccaggATGGAAGAATCACCACTAAGCCGGG
UTR dot + 25 ..(((..((((…..((..((((((((((..((((…….))))..)))..)))))))))…..)).))..)))…
RS 1 seq CAGCCGACGCGGAAGAGCCAUAUGGCACCGAAGGAGCAAGCUCCCCGCUAACCUCUCAGGUCACAGGACCGCAGUCGGCAG
RS 1 dot ..((((((((((…..((…((..(((…((((..(((…..)))…))))..)))..)))).)))).))))))..
RS 2 seq CCAGCCGAGAGGCGCUGCAACGGACAAUGACGUCCGCCACGCUCGGCGUGGGCGUUGUGACGUAAGGGCGCCUCCUGAGA
RS 2 dot .(((….((((((((…(((..(.((((((((((((……)))..)))))))))).)))…)))))))))))…
RS 3 seq GAAAGUUCGCGCGACUGGCGGAAGUGGAGUUCACCACACGGAGCGCGAGCCACGGAUCUGCCGACCGCCUGGGCUUGUUGC
RS 3 dot ..(((((((.(((..(((((((..((..((((.((…….).).))))..))..)))))))..))).)))))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table