Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA016601 Similarity: 0.981 Similarity: 0.980 Similarity: 0.980
UTR: 5HSAA016601
Gene: CANX
MFE: -14.598
ENS: 0.950
Length: 103.
Predicted Ligands:
glycine - 16/20
homocysteine - 2/20
TPP - 1/20
 RS: URS0000D7FBE2_1089454
MFE: -37.496
Ligand: glycine
Species: Gordonia terrae NBRC 100016 Glycine riboswitch
 RS: URS0000D7F2FB_1802013
MFE: -37.695
Ligand: glycine
Species: Rhodobacteraceae bacterium GWF1_65_7 Glycine riboswitch
 RS: URS0000D98884_1895824
MFE: -42.434
Ligand: glycine
Species: Rhodobacterales bacterium 65-51 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA016601 URS0000D7FBE2_1089454 URS0000D7F2FB_1802013 URS0000D98884_1895824
Length 103. 102. 104. 103.
Similarity - 0.981 0.980 0.980
Ensemble Norm 0.950 - - -
MFE -14.598 -37.496 -37.695 -42.434
Ligands - glycine glycine glycine
Gene CANX - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5. 7. 13.
Length SE - 1. 1. 0.
Lev Distance - 23. 23. 22.
UBS 7. 7. 9. 9.
BS 0. 0. 0. 0.
ILL 2. 2. 3. 2.
ILR 3. 4. 3. 3.
H 1. 1. 1. 1.
BL 2. 2. 3. 5.
BR 2. 0. 3. 2.
UN 0.019 0.020 0.029 0.019

Sequences

Field Description
UTR seq + 25 cacaagugauugcugguugagggaaguuaaacugagcuuaauauuaaaagauugagaggacaagauuaaccauagaucATGGAAGGGAAGTGGTTGCTGTGTA
UTR dot + 25 (((.((((((((((((((((…..(((…((.(((((……..))).)).))..)))….)))))))……………..))))))))))))..
RS 1 seq CGCUACGCUGCGGGAGAGCGCCGACGGCAGAGAUGCCGGCGGCCGCCGAAGGAGCAACACCUCUCCGUCAAACUCUCAGGCACCCAGGACCGCGGUGGUGAC
RS 1 dot (((..(((((((((((((….(((((.((((.(((((((….))))…..)))….)))))))))…)))))…………)))))))))))..
RS 2 seq CUGUCAGGAUCGGGAGAAUCCGGCGGGGGCCGCAAGCCUCGGAGCCGGUGCCGAAGGAGCAACCGCCCCGGUAAACUCUCAGGCGCAAGAACCGUUCUGGCACA
RS 2 dot .((((((((.(((((((..((((.((.((..((…((((((……..)))).)).))..)).))))))…..))))………..)))))))))))..
RS 3 seq UUGUCAGGAUCGGGAGAAUCCGGCGGGGGUCACUCACCUCGGAGCCGGUGCCGAAGGAGCAACCGCCCCGGUAAACUCUCAGGCGACAGGACCGUCCUGGCAG
RS 3 dot .((((((((.(((((((..((((.((.(((..(((.(.((((……..)))).))))..))).))))))…..))))………..))))))))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table