Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA016684 Similarity: 0.984 Similarity: 0.983 Similarity: 0.982
UTR: 5HSAA016684
Gene: CAP2
MFE: -20.835
ENS: 0.908
Length: 81.
Predicted Ligands:
cobalamin - 5/20
fluoride - 4/20
homocysteine - 4/20
 RS: URS0000BF9FE4_32049
MFE: -19.044
Ligand: fluoride
Species: Synechococcus sp. PCC 7002 Fluoride riboswitch
 RS: URS0000C88734_1565605
MFE: -28.375
Ligand: homocysteine
Species: Rugosibacter aromaticivorans S-adenosyl-L-homocysteine riboswitch
 RS: URS0000DA428B_282676
MFE: -24.359
Ligand: fluoride
Species: Acidianus manzaensis Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA016684 URS0000BF9FE4_32049 URS0000C88734_1565605 URS0000DA428B_282676
Length 81. 80. 81. 82.
Similarity - 0.984 0.983 0.982
Ensemble Norm 0.908 - - -
MFE -20.835 -19.044 -28.375 -24.359
Ligands - fluoride homocysteine fluoride
Gene CAP2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 4.001 7.002
Length SE - 1. 0. 1.
Lev Distance - 20. 22. 21.
UBS 6. 7. 7. 5.
BS 0. 0. 0. 0.
ILL 2. 3. 1. 1.
ILR 3. 4. 3. 3.
H 1. 1. 1. 1.
BL 2. 2. 3. 0.
BR 0. 0. 1. 1.
UN 0.099 0.087 0.123 0.146

Sequences

Field Description
UTR seq + 25 acgaguggccgaccacggauuugcauugccgaggacgggaccccagggcagcgaaaATGGCCAACATGCAGGGACTGGTGG
UTR dot + 25 ……..((.((((.(..(((((((((((..((……..))..))))……………)))))))..)))))))
RS 1 seq UUUAGCGAUGGUGAUGGAGCUCACCGAAACCGCCCAGGAUUUUUCUUAAUUGCACCUCGGCUAAUGGCUCCUACGCUUCC
RS 1 dot ……((.((((..(((((.((((((….((..((((….))))….))…))))….)))))))..)))))).
RS 2 seq GCUUCCGAGGAGCGCUGCAAGGUCGGGCCGUAUGGCUCAAACCCUAGGCUCGGAACCUGUUUUCAACGGCGCUCACCUACC
RS 2 dot ……(..((((((((((.(((((((((.((.((……)).))))))))..))))))…….)))))))..)….
RS 3 seq UUAUCUUAUGGGAAUGGCGUCUCCCAGAGGGUAACUCCCUCAAACCGCCAGAUUAAUGAUGGCUGAUGACGCCUAUCUCUAU
RS 3 dot ………((((..((((((((((((((((…..)))))………………)))..)).))))))..))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table