Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA016943 Similarity: 0.980 Similarity: 0.980 Similarity: 0.979
UTR: 5HSAA016943
Gene: CARD6
MFE: -13.422
ENS: 0.817
Length: 100.
Predicted Ligands:
purine - 16/20
Mg2+ - 3/20
TPP - 1/20
 RS: URS0000C0FF48_748449
MFE: -15.612
Ligand: purine
Species: Halobacteroides halobius DSM 5150 Purine riboswitch
 RS: URS0000AB2DB4_469605
MFE: -18.135
Ligand: purine
Species: Fusobacterium sp. 3_1_5R Purine riboswitch
 RS: URS0000ABBE90_451755
MFE: -14.373
Ligand: purine
Species: Clostridium perfringens E str. JGS1987 Purine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA016943 URS0000C0FF48_748449 URS0000AB2DB4_469605 URS0000ABBE90_451755
Length 100. 100. 101. 100.
Similarity - 0.980 0.980 0.979
Ensemble Norm 0.817 - - -
MFE -13.422 -15.612 -18.135 -14.373
Ligands - purine purine purine
Gene CARD6 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.002 5.045 3.
Length SE - 0. 1. 0.
Lev Distance - 24. 24. 27.
UBS 4. 4. 5. 3.
BS 0. 0. 0. 0.
ILL 1. 0. 0. 0.
ILR 1. 0. 1. 0.
H 3. 2. 2. 3.
BL 0. 2. 1. 0.
BR 0. 1. 1. 0.
UN 0.460 0. 0.248 0.460

Sequences

Field Description
UTR seq + 25 auucuuuuuuuaacuuuuacuuauucauuaggaugauuucauaauauauuuccugguuuagaggaaacaggaacaATGGCTACCGAGAGTACTCCCTCAG
UTR dot + 25 ………………..((((((….))))))………….((((((..((….))..))))))………..(((……..)))..
RS 1 seq UUAAAAAUAAUUAAAUAAGCGUAUAAUCUUAAGAAUAUGGCUUAAGAGUCUCUACCAGGGAGCCCUAAACUUCCUGACUACCAGUUAAGAAAUCCCUAAG
RS 1 dot ……………(((((.((((.((….)).)))))))))………..(((((((…….)))))))……………………
RS 2 seq AUUUAAAUGAAUAAACUAACUUGUAUAUACUUGUGUAUGUAUCGGGCAAGAGUCUCUACGGUUAACCGUUAUUAACCGCUACAAGUUAAAGAUAUAGAGCG
RS 2 dot ……………….(((((((((((….))))))).))))…..(.((((((((((((……)))))))…………….)))))).
RS 3 seq AAUAAAAAAUAAAUUUUGCUUCGUAUAACUCUAAUGAUAUGGAUUAGAGGUUUCUACCAAGAACCGAGAAUUCUUGAUUACGAAGAAAGCAAAUAGGCUU
RS 3 dot ……………………….(((((((…….)))))))……..((((((…….))))))……….((((……))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table