Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA017070 Similarity: 0.988 Similarity: 0.986 Similarity: 0.985
UTR: 5HSAA017070
Gene: CASK
MFE: -17.779
ENS: 0.775
Length: 71.
Predicted Ligands:
fluoride - 8/20
homocysteine - 5/20
cobalamin - 3/20
 RS: URS0000DA4BD5_1805364
MFE: -19.906
Ligand: fluoride
Species: Candidatus Rokubacteria bacterium 13_1_40CM_4_69_5 Fluoride riboswitch
 RS: URS0000BF972B_229920
MFE: -15.116
Ligand: fluoride
Species: Leptolinea tardivitalis Fluoride riboswitch
 RS: URS0000DB0A77_1331668
MFE: -36.
Ligand: cobalamin
Species: Streptomyces sparsogenes DSM 40356 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA017070 URS0000DA4BD5_1805364 URS0000BF972B_229920 URS0000DB0A77_1331668
Length 71. 70. 71. 72.
Similarity - 0.988 0.986 0.985
Ensemble Norm 0.775 - - -
MFE -17.779 -19.906 -15.116 -36.
Ligands - fluoride fluoride cobalamin
Gene CASK - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.005 7. 5.010
Length SE - 1. 0. 1.
Lev Distance - 14. 17. 17.
UBS 7. 6. 5. 6.
BS 0. 0. 0. 0.
ILL 3. 2. 3. 4.
ILR 3. 3. 2. 4.
H 1. 1. 1. 1.
BL 0. 0. 1. 1.
BR 2. 1. 1. 1.
UN 0.099 0.171 0.099 0.

Sequences

Field Description
UTR seq + 25 ccguuuucgaagcccuccacgcugcggccgcuauccccuccggaccATGGCCGACGACGACGTGCTGTTCG
UTR dot + 25 …….((((…(..(((((((((((((…(((…..)))…)))))).))..).))))..)))))
RS 1 seq GCACGAAGCGGCGAUGGGGUUCGCCUGAAACCGCCCCGCCGGAUGCGAGGCUGAUGACCCCUACCGGAAG
RS 1 dot ……..(((….(((((((((((…..(((((….))..))))))).))..)))))..)))….
RS 2 seq AAUCAAUUAAGCGAUGAAGCUCGCUCGGAAAUAAUCAAACUGUCUUUAUGGCUGAUAGCUUCUGCCUUAAA
RS 2 dot ……(((((.(..((((((…((((..((((………..))))..)))).))))))..)))))).
RS 3 seq GGGAAGCCGGUCGAAGUCCGGCGCUGACCCGCAACCGUAGGCCCGGCAUAGCGCCGGGCGAGCCGGAAUGCC
RS 3 dot ((.(..(((((….(((((((((((..(((…((…))..)))..)))))))))))..)))))..).))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table