Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA017103 Similarity: 0.984 Similarity: 0.983 Similarity: 0.983
UTR: 5HSAA017103
Gene: CASP2
MFE: -24.801
ENS: 0.777
Length: 80.
Predicted Ligands:
fluoride - 5/20
SAM - 4/20
glycine - 3/20
 RS: URS0000BEDD54_1231623
MFE: -24.992
Ligand: SAM
Species: Tanticharoenia sakaeratensis NBRC 103193 SAM riboswitch (alpha-proteobacteria)
 RS: URS0000C100B8_135735
MFE: -19.643
Ligand: glycine
Species: Bacillus endophyticus Glycine riboswitch
 RS: URS0000DB43FC_42322
MFE: -18.306
Ligand: fluoride
Species: Eubacterium ruminantium Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA017103 URS0000BEDD54_1231623 URS0000C100B8_135735 URS0000DB43FC_42322
Length 80. 80. 81. 78.
Similarity - 0.984 0.983 0.983
Ensemble Norm 0.777 - - -
MFE -24.801 -24.992 -19.643 -18.306
Ligands - SAM glycine fluoride
Gene CASP2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.001 7.001 3.
Length SE - 0. 1. 4.
Lev Distance - 19. 19. 18.
UBS 6. 7. 8. 6.
BS 0. 0. 0. 0.
ILL 0. 1. 1. 1.
ILR 0. 2. 1. 0.
H 3. 3. 3. 3.
BL 1. 2. 1. 2.
BR 3. 2. 4. 2.
UN 0.163 0.125 0.136 0.167

Sequences

Field Description
UTR seq + 25 cuuauguuggugcugaccuuagugcacaacacuaaacauuccuuucuuuuaggaaATGGCGGCGCCGAGCGCGGGGTCTT
UTR dot + 25 ….(((((((((((….)))))).)))))…..(((((((…….))))).))..(((.(((….))).)))..
RS 1 seq UCCGUCGGUCCUCGUGAUUUGAACGGCCGGCUUGCGGCGAGGUGAAACAACAGCGCUAAAGAGGCUCCCUGGGCGGCGUC
RS 1 dot …(((((((.(((…..)))..)))))))….((((..((……))..))))…((.(((((…)).))).))
RS 2 seq GGAGCAGCUUCUGGAGAGACUGCAGAAAGUUUGCGGCGCCGAAGGGUUCACAAUCUCAGGCAAAAGGACAGAAGAGUACCG
RS 2 dot …((((((((((.((…)).))))).))).))…(((..(((……..)))..)))….((((……)).)).
RS 3 seq AUUGGUAUUGGGAAUGAGGUCUCCCAAAGCAGCAUGCCUGCUUAAACCGCUUAUUAGGCUGAUGACUUCUGCAUCUUU
RS 3 dot ….((.((((((……..)))))).))…..(((((..(((…..))).))))).((((.(….)))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table