Detected as a riboswitch by 12 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA017840 Similarity: 0.977 Similarity: 0.975 Similarity: 0.975
UTR: 5HSAA017840
Gene: CAST
MFE: -28.728
ENS: 0.847
Length: 104.
Predicted Ligands:
TPP - 17/20
methionine - 1/20
tetrahydrofolate - 1/20
 RS: URS0000BE3D7E_1504319
MFE: -36.696
Ligand: methionine
Species: actinobacterium acAMD-5 S-adenosyl methionine (SAM) riboswitch,
 RS: URS0000C77D62_1262998
MFE: -35.318
Ligand: tetrahydrofolate
Species: Firmicutes bacterium CAG:102 THF riboswitch
 RS: URS0000C2C535_1736381
MFE: -39.837
Ligand: TPP
Species: Aureimonas sp. Leaf454 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA017840 URS0000BE3D7E_1504319 URS0000C77D62_1262998 URS0000C2C535_1736381
Length 104. 105. 104. 102.
Similarity - 0.977 0.975 0.975
Ensemble Norm 0.847 - - -
MFE -28.728 -36.696 -35.318 -39.837
Ligands - methionine tetrahydrofolate TPP
Gene CAST - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 7.006 7.001
Length SE - 1. 0. 4.
Lev Distance - 29. 30. 26.
UBS 9. 10. 9. 8.
BS 0. 0. 0. 0.
ILL 1. 2. 2. 2.
ILR 2. 2. 1. 2.
H 3. 2. 3. 3.
BL 5. 5. 3. 3.
BR 3. 3. 4. 2.
UN 0.135 0.105 0.058 0.108

Sequences

Field Description
UTR seq + 25 agccgagcccagcuaggaaugcagaccuccugaaaaccaagccgaggacugcgggguccgguguccacgcagaucaggcATGAATCCCACAGAAACCAAGGCTG
UTR dot + 25 ..((.(((…))).))….(((…..)))…….((((..((.(((.(((((.(.(((((………..)))))).))))).)))…))..)))).
RS 1 seq GGUUCAGAGUGCUGGCGCCAAGUCCCGACUAGCCAGACGACAACCCUCCACCGCGGUGGGGUGCCCUCGGGAAAGACCGGGCCAACACCAUGGCAAGCGCGGGUU
RS 1 dot ……..((.(((((……………)))))))…(((((.((.(((.((((..(.((((..((……)))))))..)))).)))…).).)))))
RS 2 seq CACAGAGUAGGGCUUUGCGCGUUAAGUGUCCGGUGGACGGGGAGUUGUCAUCGGAACGAAAAGCAGGAUUUCUGCUUGCGGUGCAGGACUCGCAUCCCGCUGUU
RS 2 dot ..((((((…))))))(((…..)))..((((((…(.(((((.((((((.(……(((((…..)))))).))))).).))))).)…))))))..
RS 3 seq CGCGCUCACACGGGGUGCCCAUUGGGGCUGAGAGGCGGAACGCGCCAACCCGACGAACCUGAUCCGGCUCGUACCGGCGGAGGGAUGGGGAGCGGUCCGCGG
RS 3 dot ..(((((…..)))))(((….)))…….(((((.(((.(((.(((..((……..((((……))))))..))).)))…))).)))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table