Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA017865 Similarity: 0.928 Similarity: 0.923 Similarity: 0.923
UTR: 5HSAA017865
Gene: CASZ1
MFE: -53.135
ENS: 0.959
Length: 225.
Predicted Ligands:
cobalamin - 20/20 - 20/20


 RS: URS0002317B77_1904462
MFE: -90.470
Ligand: cobalamin
Species: Stenotrophomonas sp. BIIR7 Cobalamin riboswitch
 RS: URS000232AE0F_632518
MFE: -73.131
Ligand: cobalamin
Species: Caldicellulosiruptor owensensis OL Cobalamin riboswitch
 RS: URS0002333C9D_313603
MFE: -57.123
Ligand: cobalamin
Species: Maribacter sp. HTCC2170 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA017865 URS0002317B77_1904462 URS000232AE0F_632518 URS0002333C9D_313603
Length 225. 226. 224. 225.
Similarity - 0.928 0.923 0.923
Ensemble Norm 0.959 - - -
MFE -53.135 -90.470 -73.131 -57.123
Ligands - cobalamin cobalamin cobalamin
Gene CASZ1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 44.001 18.005 14.014
Length SE - 1. 1. 0.
Lev Distance - 76. 94. 98.
UBS 10. 15. 13. 11.
BS 0. 0. 1. 0.
ILL 4. 7. 6. 2.
ILR 5. 6. 5. 3.
H 4. 3. 4. 6.
BL 1. 3. 3. 1.
BR 0. 2. 0. 1.
UN 0.062 0.027 0.134 0.182

Sequences

Field Description
UTR seq + 25 ccgcccgcccgcucccuccugccaaacuguuacccugaguguuaccggcaggagcaaugacaucagggcuuuaaaacaacuuguuauucggggaguaaucaguugcaauuaggcauuaauuaaguauuaugaaaguugauuauuuaagugaauucggcuuucgacucuccgacuaugaguuugggaccaaggagaagagaATGGATCTTGGAACAGCTGAGGGCA
UTR dot + 25 ..((((………((((((((.(((………….)))…))))))))………..))))……..(((((((…(((((((((……………………………((((((((((((((….))))..)))))))))))))))))))..)))))))..(..(((((……………)))))..).(((…))).
RS 1 seq ACACUGCGCGCACUUUCAGGUGACCUGCGGCGCAUGCCGGCAGGUUGAAACGGGAAGCCGGUGACGCAACAGGUCCUGCCUGCUGCCAGUCCGGCACUGCCCCCGCAACGGUAAGCGUGGAAAAGCCAGGCAAUACGCCACUGUGCUCGUGCAUGGGAAGGCGCCUGGUGCGAUGGCAUGCCAUCGGCCCGCAAGUCCGGAGACCGGCCUGGAAGACGACGGGUUG
RS 1 dot ..((((.(((……(((((((((((..(((…((((((……………))))))..)))..))))))..))))).)))))))..((((.((((..(((………………(((((((…..(((.((((((….))))))…)))))))))))))..))))))))..((((((((…(((((……..)))))….).)))))))
RS 2 seq CCUUUUACCUAUCAAGCAGGUGCUGCUAUUUAGGCGGCUUAAUAGGGAAAGCGGUGAAAAUCCGCUGCAGCCCCCGCUACUGUGAGCACUGACAAUCCCUCAAAAAGUUUUUGCCACUGGAAGGUUUGGGUUCCUAUUUUGAAAGUGGAGCUUACCUUCUGGGAAGGCAGAGAGGGUGCGAAUGAAGUGCGAGCCAGGAGACCUGCCUGCUUGAGAUGCCUUGU
RS 2 dot ………..(((((((((.((((((…..))))))……(((…((((((……))))))…)))(((.(((((..(((……..(((((……..((((((.(((((((((..(((((((..((….))..))))))))))))))))…))))))))))))))..))..))))))…((((…)))))))))))))……….
RS 3 seq UAUUUUUGCACUGAAUUUGGUUUUGUCACUUUCACGGUGACUAAAUUAAAAGGGAAUCCAGUGAAAAUCUGGUACUGUUCCCGCAACUGUAAGUUUAUGCCAAACUUGAUUUGGCACCUCUAUAAAAGAGGGUGUUGUUUUCUUCAAAGUCACUGUCCGUAGAUGGAUGGGAAGGCGAAAUAACAUUGAACAAGUCAGGAGACCUGCCAACUUCAAACAAACAUU
RS 3 dot ……………((((((((.((((((…..)))))).)))))))).((((((((((…….))))….))))))……………(((((((…..)))))))(((((…..)))))((((((((((((((…….((((((……))))))))))..))))))))))((((…..((((…))))…..))))……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table