Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA018083 Similarity: 0.969 Similarity: 0.967 Similarity: 0.967
UTR: 5HSAA018083
Gene: CCAR1
MFE: -36.108
ENS: 0.844
Length: 133.
Predicted Ligands:
cobalamin - 8/20
TPP - 4/20
molybdenum - 3/20
 RS: URS00023279E8_1618944
MFE: -26.750
Ligand: cobalamin
Species: Parcubacteria group bacterium GW2011_GWD2_42_14 Cobalamin riboswitch
 RS: URS000232AC67_355249
MFE: -48.327
Ligand: cobalamin
Species: Streptomyces sp. Tu6071 Cobalamin riboswitch
 RS: URS0000D8E902_1703924
MFE: -57.983
Ligand: cobalamin
Species: Streptomyces sp. CB02056 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA018083 URS00023279E8_1618944 URS000232AC67_355249 URS0000D8E902_1703924
Length 133. 131. 133. 134.
Similarity - 0.969 0.967 0.967
Ensemble Norm 0.844 - - -
MFE -36.108 -26.750 -48.327 -57.983
Ligands - cobalamin cobalamin cobalamin
Gene CCAR1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 14.003 7. 6.
Length SE - 4. 0. 1.
Lev Distance - 31. 41. 41.
UBS 10. 10. 9. 11.
BS 0. 0. 2. 0.
ILL 2. 2. 2. 2.
ILR 0. 2. 1. 1.
H 3. 3. 3. 3.
BL 5. 2. 4. 5.
BR 2. 3. 2. 4.
UN 0.135 0.191 0.150 0.119

Sequences

Field Description
UTR seq + 25 augcgccuaaagcugacggguuugaaauggcuucgauguuagccgggacccgacucagaucgaugcuauagaagacaaacaagggaagguuuuuuuuccuuuugcaucATGGCTCAATTTGGAGGACAGAAGA
UTR dot + 25 ..((…….))…(((((((….(((((……..))))))))))))..((((((.((.(((((.((.(.((((…(((((((….)))))))))))).))))))))).))))))………..
RS 1 seq AUAGAUAUGCUAUUCUUGCGCACAGUUACAGUCUUUUUGUUGACGAAUGAGGUGUAACUCCUCAGCUGACCCGCAACUGUGAAGUCUCCAUAUAGGAGAAUAAGCCAGGUCGCGCAAUGAAAGACUACUAA
RS 1 dot ……..((…….))….(((((((.((((((((….)))).)))))))))))..((((((((((.((…(((….(((((…..)))))))).))..))))).))..)))………..
RS 2 seq GAGCGAUAUCGUCCCGAUGACCUUACAAGCGACAUGACGGAAUCCGGUGAGAGCCCGGAACGGUCGCGCCACUGUAUGCCGGGCCCGUACGCGGGCCCCGGUGAGUCAGACCCGUCAUGCGCGUUCGAAGCUC
RS 2 dot (((.(.(((((…))))).))))….(((.(((((((…(((((.(….))))))..((((..(((((((……(((((((….)))))))))))).))..))))))))))))))………..
RS 3 seq AGAGGAAGCCGGUGGAAGUCCGGCGCGGUCCCGCCACUGUCACCGGGGAGCACGCUCGGAACAUCGCCACGGCGGGCCGUCGACGGCUGCUGGAAGGCUCCGGGGGUGCGUUCGACCCGGAAGCCAGGAGACUC
RS 3 dot ……..(((((((.(((..((((……))))))).)))))))(((((((.((((((…..(((.((((.(((((….)))))))))…))))))))).)))).)))..((.((…)).))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table