Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA018163 Similarity: 0.955 Similarity: 0.954 Similarity: 0.953
UTR: 5HSAA018163
Gene: CCDC103
MFE: -59.660
ENS: 0.693
Length: 182.
Predicted Ligands:
cobalamin - 20/20 - 20/20


 RS: URS000231D85E_1293441
MFE: -42.741
Ligand: cobalamin
Species: Lysinibacillus contaminans Cobalamin riboswitch
 RS: URS0002317944_1236973
MFE: -40.538
Ligand: cobalamin
Species: Bacillus akibai JCM 9157 Cobalamin riboswitch
 RS: URS0002317109_1801870
MFE: -61.286
Ligand: cobalamin
Species: Omnitrophica WOR_2 bacterium RIFCSPLOWO2_12_FULL_51_8 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA018163 URS000231D85E_1293441 URS0002317944_1236973 URS0002317109_1801870
Length 182. 183. 183. 182.
Similarity - 0.955 0.954 0.953
Ensemble Norm 0.693 - - -
MFE -59.660 -42.741 -40.538 -61.286
Ligands - cobalamin cobalamin cobalamin
Gene CCDC103 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.004 11.001 7.009
Length SE - 1. 1. 0.
Lev Distance - 55. 55. 59.
UBS 12. 14. 12. 12.
BS 0. 0. 0. 0.
ILL 3. 4. 4. 4.
ILR 3. 4. 3. 4.
H 4. 3. 3. 4.
BL 5. 5. 2. 3.
BR 3. 4. 3. 2.
UN 0.220 0.153 0.197 0.126

Sequences

Field Description
UTR seq + 25 aguugcuaggcaaccacagcugcgggcguggucugcgcgggguugcccuccuguucugguuuaucaggggauccccaaagaaagcaaggggaccaaggccgggacugcuggggugaagguccgggaggcugaguaaggggacggaagggcacaggccATGGAAAGGAATGACATCATCAACT
UTR dot + 25 ……..(((((((.(.((.((((((…)))))))).))))))))((((((………..)))))).(((((……(((….(((((..(.((.((….)).)).)…)))))…..)))……)))))……(((….)))…………………….
RS 1 seq ACAACAAUAUCAUUUUUUGGUGCAAGAUGCAUGCAUUUUGCUUAAAAGGGAAGCCGGUUCAAGUCCGGCGCGGUCCCGCCACUGUAAUAGGGAGUUUUAUAGAAAUGUCACUGUCCAACGGAUGGGAAGACCUAUAAAAUGAUGAACUAGAGCCAGGAGACCUGCCAAAAAAAGUGUGAUCGU
RS 1 dot ………((.((((((((.((((((((….)))))))))))))))))).(((((…….)))))((((((((….((.((.(..(..(((((((((….(((.(((((…..)))))…))))))))))))..)..).)).))…)).)))).))………………
RS 2 seq AUAAGAAAAAAUUCUAUAGGUCAUUUAGUCAUUAAAUGAUAAUAGGGAAGUUGGUGUAAUUCCAACACGGUCCCGCCACUGUAAAUGCGAAAUUACUUCAAUUACCACUGUCUAUAAUGAGAUGGGAAGGUGAAGUGAUUGUUAAGCAUGAGUCAGGAGACCUGCCUAUAGAGAAUGUGAAAC
RS 2 dot ………..((((((..((((((((…..)))))))).))))))..(((((…….)))))..((((((((((.(((….((((..(((((((….(((.((((((……))))))…))))))))))))))…))))).))..)).))))…………………
RS 3 seq GCGUGAUUUUUAGAUACGGGUUAGGGAAAUCCGUGAAACGGAUGCGGUCCCGCCGCUGUAGGGGUGGACGAAAGCUGCAAAAGUCACUGUUCUGCGCCGAGUAAACUAAGCGCGGAGCGGGAAGACGCGGCCGGUAGGAUGAGGCCCCAAGCCAGAAGACCUGCCUGUAAAAAUAUAUAAUG
RS 3 dot .(((.((((…..((((((((…..))))))))….)))))))(((((.((……)).).))))….(((((….(((.(((((((((((..((….))..)))))))))))…)))))))).((((((….(((…..)))……))))))……………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table