Detected as a riboswitch by 6 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA018164 Similarity: 0.963 Similarity: 0.961 Similarity: 0.961
UTR: 5HSAA018164
Gene: CCDC103_0
MFE: -53.444
ENS: 0.833
Length: 152.
Predicted Ligands:
FMN - 17/20
cobalamin - 2/20
TPP - 1/20
 RS: URS0000C208B8_1770058
MFE: -57.890
Ligand: FMN
Species: Devosia sp. S37 FMN riboswitch (RFN element)
 RS: URS0002325A1B_1090375
MFE: -48.737
Ligand: cobalamin
Species: Burkholderia sp. BR2004143571 Cobalamin riboswitch
 RS: URS0000C54DC0_303
MFE: -59.940
Ligand: FMN
Species: Pseudomonas putida FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA018164 URS0000C208B8_1770058 URS0002325A1B_1090375 URS0000C54DC0_303
Length 152. 152. 150. 152.
Similarity - 0.963 0.961 0.961
Ensemble Norm 0.833 - - -
MFE -53.444 -57.890 -48.737 -59.940
Ligands - FMN cobalamin FMN
Gene CCDC103 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.004 3.001 13.014
Length SE - 0. 4. 0.
Lev Distance - 45. 46. 47.
UBS 10. 12. 10. 12.
BS 0. 0. 0. 0.
ILL 1. 1. 0. 1.
ILR 0. 1. 0. 1.
H 4. 4. 5. 4.
BL 5. 4. 5. 3.
BR 3. 5. 2. 5.
UN 0.197 0.138 0.160 0.079

Sequences

Field Description
UTR seq + 25 aguugcuaggcaaccacagcugcgggcguggucugcgcgggguugcccuccuguucugguuuaucaggggauccccaaagaaagcaaggggaccaaggccgggacugcuggggugaaggcacaggccATGGAAAGGAATGACATCATCAACT
UTR dot + 25 ……..(((((((.(.((.((((((…)))))))).))))))))((((((………..)))))).(((((………..)))))(((.((((.(…((((……..))))).)))).)))…………………
RS 1 seq AGACGUUCUCAGGGCGGGGUGCAAUUCCCCACCGGCGGUGUUUGCAUCCCACAGAUGCAUCAGCCCGCGAGCGCCCUCCCCAAAAGGGAGGGGUCAGCAGACUCGGUUCAACUCCGAGGCCGACGGUAUAGUCCGGAUGGAAGAGAACACAU
RS 1 dot …(((((.(.((((((((((((((.((((…)).)).))).)))))))…………))))).)))))(((((((…..)))))))(((.((…(((((…….))))))).)))…….(((….)))………..
RS 2 seq CCAUUGCUUUACUUUGCCGGCAUUCGUCAUAAAAUGGCAAGCUUGCAAAGCGAGGAAGCCGGUGCAAGUCCGGCACGGUCGCGCCACUGUAAGCGGUCGUCGUUUUUUUCGGCACCGCAAGUCAGACCCCGCUGCAAGCUCUUAGCGAUC
RS 2 dot ……((((.((((((.(((.((.(((((…)))))))))).)))))).))))..(((((…….)))))(((((……)))))..(((((.((((…….)))))))))………..(((((……..)))))…
RS 3 seq GCACGUUCUCAGGGCGGGGUGCAAUUCCCCACCGGCGGUAAUUGCGCCCAUUGCGCAUAGCCCGCGAGCGCUUGCAGGCAACCCUGCAAGGUCAGCAGACCCGGUGUGAUUCCGGGGCCGACGGUCAUAGUCCGGAUAAAGAGAGAGCGGGA
RS 3 dot …(((((.(.(((((((((((((((((((…)).)).)))))))))).)……..))))).)))))((((((((….))))))))(((.((…(((((…….))))))).)))……..((((………….)))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table