Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA018165 Similarity: 0.960 Similarity: 0.953 Similarity: 0.952
UTR: 5HSAA018165
Gene: CCDC103_1
MFE: -57.444
ENS: 0.769
Length: 162.
Predicted Ligands:
FMN - 6/20
cobalamin - 4/20
glucosamine - 4/20
 RS: URS0000C3BA14_1318466
MFE: -31.954
Ligand: Mg2+
Species: Acholeplasma palmae J233 M-box riboswitch (ykoK leader)
 RS: URS0000D9B299_1977292
MFE: -56.874
Ligand: FMN
Species: Bacillus xerothermodurans FMN riboswitch (RFN element)
 RS: URS0000D7D8E2_1965583
MFE: -42.821
Ligand: Mg2+
Species: Lachnoclostridium sp. An196 M-box riboswitch (ykoK leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA018165 URS0000C3BA14_1318466 URS0000D9B299_1977292 URS0000D7D8E2_1965583
Length 162. 161. 162. 162.
Similarity - 0.960 0.953 0.952
Ensemble Norm 0.769 - - -
MFE -57.444 -31.954 -56.874 -42.821
Ligands - Mg2+ FMN Mg2+
Gene CCDC103 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.005 6.010 3.
Length SE - 1. 0. 0.
Lev Distance - 51. 61. 63.
UBS 11. 11. 11. 11.
BS 0. 0. 1. 0.
ILL 1. 1. 1. 1.
ILR 1. 2. 3. 2.
H 4. 5. 4. 3.
BL 5. 4. 4. 4.
BR 4. 4. 4. 4.
UN 0.160 0.087 0.062 0.148

Sequences

Field Description
UTR seq + 25 gcuaggcaaccacagcugcgggcguggucugcgcgggguugcccuccuguucugguuuaucaggggauccccaaagaaagcaaggggaccaaggccgggacugcuggggugaagguccgggaggcugagcacaggccATGGAAAGGAATGACATCATCAACT
UTR dot + 25 ….(((((((.(.((.((((((…)))))))).))))))))((((((………..)))))).(((((………..)))))(((.((((((..((.(((((…….))))).)).))…….)))).)))…………………
RS 1 seq AAUCAUUGCUGGUAGGUGAGGCUACUUUAAGGAUACGGAUUACUGCCGUCACUUUGUGGAGACAAAAAGUGUUUGGUUUGAAAAGUCUAAAUCGGAUCAAGGUUUAGAAUAAUGUAAUUUCAUUGCCUUAUUGAGCUAAAACUUAAACAUUGGCUUUUUAA
RS 1 dot .(((.(((..(((((……))))).))).)))((((…….))))((((((.((….)).))))))…(((.((((((.((((((((…….)))))))).)…….)))))..)))…..(((((((……….)))))))…..
RS 2 seq GAUUUCCUUCGGGGCGGGGCGAAAUUCCCCACCGGCGGUGAUACAAUGCGAAUUCUCGCGCGUUGUUCAGUCCGUGACCCGGCCGCGGCAGCAUCUGGCGCAUCCGGUGGACUCGGUGUGAUUCCGAGACCGACAGUAUAGUCUGGAUGGGAGAAGGAAACG
RS 2 dot ..((((((((..((.((((…….)))).)).(((((((.((((((((……..)))))))))))..))))…((((..((….))..))))(.((((((((((.(((((…….))))).)))……….))))))).).))))))))..
RS 3 seq GGCAUUGUUCGGUAGGUAAGGCUACUGCAGGGAUAUGGGCUGUUGCCGCGAAAUGGUGGAGACACCAUGAGCUGGUUUGAACAGGGUACAUCGAAAGCAAGGUGUAUCAUAAUACAGUUUCACCGCCCUGCAAAGUUAAAGCUCAGACGAAUGAAGAGAAGU
RS 3 dot …(((.((((((((……)))))).)).)))…((.((((.((((……)))).)))))).(((((((.((((..(((((((((((……..)))))……………….)))))))))).)…))))))……………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table