Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA018290 Similarity: 0.972 Similarity: 0.967 Similarity: 0.967
UTR: 5HSAA018290
Gene: CCDC127
MFE: -40.376
ENS: 0.997
Length: 125.
Predicted Ligands:
TPP - 8/20
cobalamin - 5/20
SAM - 2/20
 RS: URS0000AB79A0_12908
MFE: -23.208
Ligand: cobalamin
Species: unclassified sequences AdoCbl variant RNA
 RS: URS0000AB2F47_12908
MFE: -26.197
Ligand: cobalamin
Species: unclassified sequences AdoCbl variant RNA
 RS: URS0002313BB3_1906740
MFE: -50.373
Ligand: cobalamin
Species: Streptomyces sp. CC53 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA018290 URS0000AB79A0_12908 URS0000AB2F47_12908 URS0002313BB3_1906740
Length 125. 125. 126. 124.
Similarity - 0.972 0.967 0.967
Ensemble Norm 0.997 - - -
MFE -40.376 -23.208 -26.197 -50.373
Ligands - cobalamin cobalamin cobalamin
Gene CCDC127 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11.002 4. 6.002
Length SE - 0. 1. 1.
Lev Distance - 32. 41. 40.
UBS 11. 9. 11. 10.
BS 0. 0. 0. 0.
ILL 5. 3. 4. 3.
ILR 3. 4. 2. 3.
H 2. 2. 3. 2.
BL 3. 2. 3. 3.
BR 3. 2. 4. 4.
UN 0.120 0.160 0.111 0.073

Sequences

Field Description
UTR seq + 25 gguacugagugggggcgccgcgccugcgcaaagcggacccgcggacgguggcguuaagggaacgcugaggucccgcgcuccccgaccgagguauaucuccATGAATAACCTAAATGATCCCCCAA
UTR dot + 25 (((……(((((((((.(.((((.(….((((..(((…((((….))))..)))..))))))))).).)))).)))))))).((((…((…..))…))))…………..
RS 1 seq AUAUUGUCGGUGGGAAAUUAGUGUGAAAUUCACUUGCUGUUCCUGCAACGGUUAAAGUCCGAAUGCCACCCAAUAAAGUCCGCUGUGAAUGAAGGCCAGGAAAAGUCUAAUUCUACAAUGAAAAA
RS 1 dot …….(((((((..(((.(.(((..((((((((((((((…..))))))..))))..))))..)))).)))….))))))).((((..((((……..)))).))))…………
RS 2 seq CUGUUGAAUUGGUGGGGAAUCAGUGUGAAAUUCAUUGGCUGUACCUGCAACCGUAAAGUCGGAGUGCCGCCCAACAGAGUCCGCUGUGAAUGAUGGCCAGGAAAAGUCUAGUUCUACAAUGAAAAA
RS 2 dot ((((((….(((((…..((.(.(((..((…(((.(((….))).))).))..))).).)))))))))))))..((((((((…..)))))..)))………(((……)))…
RS 3 seq AUGCUCAUCCUCGCUGUCGCUGCAGGGGAAUCCGGUGCGAAUCCGGAACUGUCCCGCAACGGUGUGAAGGGUGCCCAUUCGUGCACCCGGCAGUCCGAUGACCUGCCGACAGUGCGCCCGGACC
RS 3 dot (((..(((((((((..(((.(((.((((..(((((…….)))))….))))))).))).)))).)))))..)))..((((((.((((((((….))).)))))…))))))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table