Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA018349 Similarity: 0.984 Similarity: 0.983 Similarity: 0.983
UTR: 5HSAA018349
Gene: CCDC138
MFE: -32.992
ENS: 0.970
Length: 85.
Predicted Ligands:
zmp-ztp - 7/20
cyclic-di-GMP - 5/20
homocysteine - 4/20
 RS: URS0000C63771_1776083
MFE: -34.870
Ligand: zmp-ztp
Species: Microbacterium sp. T32 ZMP/ZTP riboswitch
 RS: URS0000D9CFFA_1798250
MFE: -32.242
Ligand: homocysteine
Species: Gallionellales bacterium RBG_16_57_15 S-adenosyl-L-homocysteine riboswitch
 RS: URS0000C51A89_1618345
MFE: -18.227
Ligand: cyclic-di-GMP
Species: candidate division CPR2 bacterium GW2011_GWC2_39_10 Cyclic di-GMP-II riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA018349 URS0000C63771_1776083 URS0000D9CFFA_1798250 URS0000C51A89_1618345
Length 85. 86. 85. 86.
Similarity - 0.984 0.983 0.983
Ensemble Norm 0.970 - - -
MFE -32.992 -34.870 -32.242 -18.227
Ligands - zmp-ztp homocysteine cyclic-di-GMP
Gene CCDC138 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.007 4.002 4.004
Length SE - 1. 0. 1.
Lev Distance - 19. 21. 20.
UBS 7. 9. 7. 8.
BS 0. 0. 0. 0.
ILL 1. 2. 1. 2.
ILR 2. 2. 2. 3.
H 1. 1. 1. 1.
BL 5. 5. 3. 4.
BR 3. 3. 3. 3.
UN 0.153 0.070 0.106 0.093

Sequences

Field Description
UTR seq + 25 guagcgccgcggguuugaugaacgcgguucccggggagacugguacgguugcugugugcuATGGAGCCGAGGGTCGTCAAGCCAC
UTR dot + 25 ………..((((((((((.(.(((((((..((.(.((.((((….)))))).).))..))))))).)..))))))))))..
RS 1 seq UGAGGGCGUCGCGACUGGCGUUGAGGUGGGGAACCACCGGGGAGCGACCGCUUGACGGUAUUCGACCGCACGCCUGGGUCGGUGCG
RS 1 dot …..(((.(.(((((((((.((.(((.(((….((((..((((….))))..)))).))).))).))))))..))))))))).
RS 2 seq GCCUCCGAGGGGUGCUGCAGCGGGACUGGACACCGGUCUCCCGUCAGGCUCGGAGCCGCAACCGUUUCAACGGCACCCAUUCAUU
RS 2 dot ……(((((((((((.(((((…(((.(.(((((((……)))).))).))))…)))))….)))))))).)))…
RS 3 seq UAUUCUAACGAAAGCUAUGACCCGCGACAUAUAUAUGGUCACCUUAUGGUCGCAGGUAGCUAGUGGUGAAACCGGUCGUUUUUUUG
RS 3 dot ……..((((((..(((((((((.((.((..(((.((.(((….))).))..)))..)))).)))…..)))))).))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table