Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA018350-1 Similarity: 0.981 Similarity: 0.979 Similarity: 0.979
UTR: 5HSAA018350-1
Gene: CCDC138_0
MFE: -43.593
ENS: 0.984
Length: 96.
Predicted Ligands:
glycine - 13/20
TPP - 5/20
cobalamin - 1/20
 RS: URS0000AB7ACC_443255
MFE: -32.239
Ligand: glycine
Species: Streptomyces clavuligerus ATCC 27064 Glycine riboswitch
 RS: URS0000D7848E_1546107
MFE: -39.251
Ligand: glycine
Species: Streptomyces sp. NBRC 110027 Glycine riboswitch
 RS: URS0000C84F6B_1621259
MFE: -39.251
Ligand: glycine
Species: Streptomyces sp. NBRC 110611 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA018350-1 URS0000AB7ACC_443255 URS0000D7848E_1546107 URS0000C84F6B_1621259
Length 96. 95. 96. 96.
Similarity - 0.981 0.979 0.979
Ensemble Norm 0.984 - - -
MFE -43.593 -32.239 -39.251 -39.251
Ligands - glycine glycine glycine
Gene CCDC138 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 4.003 4.003
Length SE - 1. 0. 0.
Lev Distance - 23. 26. 26.
UBS 9. 10. 10. 10.
BS 0. 0. 0. 0.
ILL 1. 0. 0. 0.
ILR 2. 3. 2. 2.
H 2. 2. 2. 2.
BL 6. 6. 5. 5.
BR 3. 3. 4. 4.
UN 0.042 0.021 0.094 0.094

Sequences

Field Description
UTR seq + 25 acugcggccgcguagcgccgcggguuugaugaacgcgguucccggggagacugguacgguugcugugugcuATGGAGCCGAGGGTCGTCAAGCCAC
UTR dot + 25 .((((((.(((…)))))))))(((((((((.(.(((((((..((.(.((.((((….)))))).).))..))))))).)..)))))))))…
RS 1 seq UGAAUCCGCGCGGGAGAGUUCCGGCACUGUGUGCCGGGCGCCGAAGGAGCAAGUCCCUCCCUUGAAUCUCUCAGGCCCCGUACCGCGCGUGACGA
RS 1 dot .((((((…..)))…)))((.(((.(((((.((((.(((((.(((.((((…….))))..))).)).)))))))…)))))))).)).
RS 2 seq UGAACCCGCGCGGGAGAGUCCCCGGCCGCCACGGCGGGGCGCCGAAGGAGCAAGUCCUCCCUUGAAUCUCUCAGGCCCCUAUACCGCACGGGCGAG
RS 2 dot …….((.((((……))))))((((.((((((((.(((((.(((.((((……))))..))).)).))).))….)))).))))))..
RS 3 seq UGAAUCCGCGCGGGAGAGUCCCCGGCCGCCACGGCGGGGCGCCGAAGGAGCAAGUUCUCCCUUGAAUCUCUCAGGCCCCUAUACCGCGCGGGCGAG
RS 3 dot …….((.((((……))))))((((.((((((((.(((((.(((.((((……))))..))).)).))).))….)))).))))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table