Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA018358 Similarity: 0.982 Similarity: 0.981 Similarity: 0.980
UTR: 5HSAA018358
Gene: CCDC138_1
MFE: -37.243
ENS: 1.
Length: 96.
Predicted Ligands:
TPP - 15/20
purine - 2/20
cobalamin - 2/20
 RS: URS0000C14189_396014
MFE: -39.487
Ligand: TPP
Species: Brachybacterium phenoliresistens TPP riboswitch (THI element)
 RS: URS0000D984E3_1955065
MFE: -33.538
Ligand: TPP
Species: Streptomyces sp. M41(2017) TPP riboswitch (THI element)
 RS: URS0000D8CF4F_564117
MFE: -34.623
Ligand: TPP
Species: Marinobacter sp. ZS2-30 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA018358 URS0000C14189_396014 URS0000D984E3_1955065 URS0000D8CF4F_564117
Length 96. 96. 95. 96.
Similarity - 0.982 0.981 0.980
Ensemble Norm 1. - - -
MFE -37.243 -39.487 -33.538 -34.623
Ligands - TPP TPP TPP
Gene CCDC138 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9.001 18.002 8.003
Length SE - 0. 1. 0.
Lev Distance - 21. 18. 24.
UBS 6. 8. 9. 7.
BS 0. 0. 0. 0.
ILL 1. 3. 3. 3.
ILR 1. 2. 1. 0.
H 2. 2. 2. 2.
BL 3. 3. 2. 2.
BR 1. 1. 3. 2.
UN 0.062 0.031 0.105 0.115

Sequences

Field Description
UTR seq + 25 gcacugcggccgcguagcgccgcggguuugaugaacgcgguucccggggagacuguaugauuuuucaaauuATGGAGCCGAGGGTCGTCAAGCCAC
UTR dot + 25 …((((((.(((…)))))))))(((((((((.(.(((((((…………(((((((…)))))))))))))).)..)))))))))…
RS 1 seq GGGCGUGACACGGGGUGCCGCCACGCGCGGCUGAGAACAUACCCGUCGAACCUGAUCCAGUUCACGCUGGCGGAGGGAUUGUCGCAGCGGCCGCGC
RS 1 dot .((((.(.(((…))))))))..(((((((((…(((..(((.(((……..(((((….)))))))).)))..)))…..)))))))))
RS 2 seq GUACCGGACACGGGGUGCCCCGUCCGAGGGCUGAGAUCACACCCGUCGAACCUGAACCAGUUCGUACUGGCGGAGGGAUGUCUUCCAUGCCAUUG
RS 2 dot ….(((((..(((….))))))))..(((((.((..((((((.(((……..(((((….)))))))).))).)))..)))).)))….
RS 3 seq UGAUUCGACACGGGGUGUCCUGCUUGCAGGGCUGAGAUAACACCCGUUGAACCUGAUCCAGUUCACACUGGCGAAGGGAUGUCAGCCGCAGGCGUC
RS 3 dot ……(((((…)))))..((((((..((((((.((….(((.(((……..(((((….)))))))).))))).))))))))))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table