Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA018359 Similarity: 0.987 Similarity: 0.984 Similarity: 0.984
UTR: 5HSAA018359
Gene: CCDC138_2
MFE: -29.443
ENS: 0.996
Length: 65.
Predicted Ligands:
unknown - 6/20
fluoride - 6/20
cobalamin - 6/20
 RS: URS0000D69E19_12908
MFE: -22.320
Ligand: unknown
Species: unclassified sequences nhaA-I RNA
 RS: URS0002315E0D_78245
MFE: -25.
Ligand: zmp-ztp
Species: Xanthobacter autotrophicus Py2 ZMP/ZTP riboswitch
 RS: URS0000D678DE_12908
MFE: -19.557
Ligand: unknown
Species: unclassified sequences nhaA-I RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA018359 URS0000D69E19_12908 URS0002315E0D_78245 URS0000D678DE_12908
Length 65. 66. 65. 63.
Similarity - 0.987 0.984 0.984
Ensemble Norm 0.996 - - -
MFE -29.443 -22.320 -25. -19.557
Ligands - unknown zmp-ztp unknown
Gene CCDC138 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 4.002 4.003
Length SE - 1. 0. 4.
Lev Distance - 15. 20. 16.
UBS 5. 6. 6. 5.
BS 0. 0. 0. 0.
ILL 0. 0. 1. 1.
ILR 1. 1. 1. 0.
H 2. 2. 2. 2.
BL 3. 4. 2. 2.
BR 1. 2. 2. 0.
UN 0.092 0.061 0.138 0.143

Sequences

Field Description
UTR seq + 25 gcacugcggccgcguagcgccgcggguuugaugaacgcggATGGAGCCGAGGGTCGTCAAGCCAC
UTR dot + 25 …((((((.(((…)))))))))(((((((((.(.(((……))).)..)))))))))…
RS 1 seq GGGUUCGAAGGCACACUGUGUGCUUUCGGAGGAUAGACGGGUAGCAAAUGGUCGGGCCGCCAUUCG
RS 1 dot …((((((((((((…))))))))))))((((.(.(((.(.((…..))..).)))).)))).
RS 2 seq AUGUCCCUGCGUGACUGGCGGCAGGGCAACGCAGGAUUCUCUCGCCGCGGGCCUGGGCGUCCCUC
RS 2 dot .((.((((((((…..))).)))))))…..((((.(((..(((…)))..))).))))…
RS 3 seq CGGUGCCAGCUGCGAGGUGCAGUGGGGCAGGUUAAUUCGAUAGCGCAGGUCGGGCCGCCAGCG
RS 3 dot …..(((.((((…..)))))))(((.(((….(((((…….)))))))))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table