Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA018428 Similarity: 0.956 Similarity: 0.956 Similarity: 0.955
UTR: 5HSAA018428
Gene: CCDC158
MFE: -22.232
ENS: 0.898
Length: 178.
Predicted Ligands:
cobalamin - 16/20
FMN - 3/20
glucosamine-6-phosphate - 1/20
 RS: URS000231AC98_469618
MFE: -29.663
Ligand: cobalamin
Species: Fusobacterium varium ATCC 27725 Cobalamin riboswitch
 RS: URS000232CD84_1971726
MFE: -44.851
Ligand: cobalamin
Species: Candidatus Cloacimonetes bacterium 4572_55 Cobalamin riboswitch
 RS: URS000231F3FE_653733
MFE: -52.210
Ligand: cobalamin
Species: Desulfurispirillum indicum S5 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA018428 URS000231AC98_469618 URS000232CD84_1971726 URS000231F3FE_653733
Length 178. 177. 177. 178.
Similarity - 0.956 0.956 0.955
Ensemble Norm 0.898 - - -
MFE -22.232 -29.663 -44.851 -52.210
Ligands - cobalamin cobalamin cobalamin
Gene CCDC158 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 14.001 2.001 17.001
Length SE - 1. 1. 0.
Lev Distance - 50. 57. 52.
UBS 12. 12. 12. 15.
BS 0. 0. 0. 0.
ILL 4. 5. 3. 6.
ILR 3. 1. 3. 3.
H 4. 4. 5. 4.
BL 3. 3. 3. 3.
BR 3. 6. 3. 5.
UN 0.163 0.186 0.186 0.135

Sequences

Field Description
UTR seq + 25 gcacgaagcauauuaagguagauauguucuaucguuaauuguaguuuugacagguggcaucucaguaaucaaaaggaagaaaaugaaccaaaagaaccaaagagggaaccauucauacuucaagaucucuaauaagaaguagcaauauuuaauATGGAATCAAAAGCTTGGGAATCAA
UTR dot + 25 …….(((.(((((((((((…..)))))).))))))))..((((((..(.(((….))).)..)))))).((((…(((((………((…..))……))))).))))..(((.((((…..(((((….)))))….)))))))……………..
RS 1 seq UAUAUGAUGUUUAUUCUAAGUUUUAUUAAUUAAAAGGGAAUUGAGUGAAAAUCUCAAACGGUCCGGCCGCUGUGAUUUAGCAAAUAGUUUUCAAAUACCAUUGGAUUUAAUGUCUGAGAAGGAGAAAACUGUGAUUGAGCUAUGAGUCAGAAGACCUGCUUAGAAAGAUUAUUGUAC
RS 1 dot …………(((((…(((((…..))))).)))))…((..(((((.((..((((…)))).)).))))).))..(((((((((…..((.((((((…..))))))…)).)))))))))..((((((…(.(((….)))).))))))…………..
RS 2 seq ACAUAUUCGGCAUUAACAAGUGCCAUAAGGCUUAAUCGGGAAACCGGUGCGAUUCCGGUACAGUCCCCGCUACUGUAAUUGGUGACAAACCCAACCACGCCACUGUCCUGUAGAUGGGAAGGCAUGGGUGACGGAUGAUCCAUGAGUCAGGAGACCUGCUUGAUAAUGCGCUGGACC
RS 2 dot ……..((((((….))))))….((((..(((((((…((…)).)))))))..))))((((((((.(..(.(((((………….))))).)..)..)))).))))….(((((((……..)))))))((.((((…))))))……………..
RS 3 seq CGUUUAGUUCUCAUUUUCGGUGCCCGUAUCCGGGUGAAAAGGGAAGAGGGGUGCAAAUCCCCCGCGGACCCGCCACUGUAAGCGAUGACGAUGGAUCACAAGCCACUGGCCCGUGCCGGGAAGGCGAUCUGGAGGAUGAUUCGCAAGCCAGGAGACCUGCCGGAAAGUACACACGACC
RS 3 dot …….(((((.(((((…(((((….)))))))))))))))..((((…….))))(((((….((((..((..(.(((……..))).)..))…)))))))))((((..((((..(((((.(((….)).)…))))).).))).))))……………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table