Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA018576 Similarity: 0.987 Similarity: 0.986 Similarity: 0.985
UTR: 5HSAA018576
Gene: CCDC59
MFE: -27.490
ENS: 0.953
Length: 69.
Predicted Ligands:
homocysteine - 13/20
fluoride - 3/20
cobalamin - 3/20
 RS: URS0000DB54E5_1797183
MFE: -23.697
Ligand: fluoride
Species: Acidobacteria bacterium RIFCSPLOWO2_02_FULL_67_21 Fluoride riboswitch
 RS: URS0000D9DAB9_1797491
MFE: -21.641
Ligand: homocysteine
Species: Betaproteobacteria bacterium RIFCSPLOWO2_02_FULL_67_19 S-adenosyl-L-homocysteine riboswitch
 RS: URS0000C47065_1736522
MFE: -21.467
Ligand: homocysteine
Species: Massilia sp. Root351 S-adenosyl-L-homocysteine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA018576 URS0000DB54E5_1797183 URS0000D9DAB9_1797491 URS0000C47065_1736522
Length 69. 70. 71. 69.
Similarity - 0.987 0.986 0.985
Ensemble Norm 0.953 - - -
MFE -27.490 -23.697 -21.641 -21.467
Ligands - fluoride homocysteine homocysteine
Gene CCDC59 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.008 3.001 9.003
Length SE - 1. 4. 0.
Lev Distance - 16. 14. 17.
UBS 5. 5. 5. 7.
BS 0. 0. 0. 0.
ILL 1. 1. 2. 1.
ILR 1. 1. 0. 0.
H 2. 2. 2. 2.
BL 2. 1. 1. 4.
BR 1. 2. 1. 1.
UN 0.130 0.043 0.169 0.188

Sequences

Field Description
UTR seq + 25 gggcguccgucguggucuucugaugacgcaguuagucggcugcaATGGCGCCGGTGAGGCGGTCCGCGA
UTR dot + 25 .((((.((((.((((((..(((((……)))))..)))))).))))))))……(((…)))..
RS 1 seq CGUCUCGUUGGUGGUGGAGUCCACCUGAACCGCCGGCCCCGACUGGACGGCCAAUGACUCCUGCGGCGAU
RS 1 dot (((((.(((((((((((..((…..)).))))))…))))).)))))(((…………)))…
RS 2 seq UUUGCUGAGGAGCGUUGCGUCCCCGGAUGAAUGGGGGUCAGGCUCAGCGAAAUCAACGGCGCUCGCACUGG
RS 2 dot ((((((…((((.(((..((((((……)))))).)))))))))))))…….((….))…..
RS 3 seq CCUUCCGAGGAGCGCUGCGACCCGCCGUACGGCUGGCCAGGCUCGGAAUCAACACCGCGCUCACGUUAC
RS 3 dot ..((((…((((.(((.(.((.(((….))).))))))))))))))……..(((….)))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table