Detected as a riboswitch by 4 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA018600 Similarity: 0.976 Similarity: 0.974 Similarity: 0.974
UTR: 5HSAA018600
Gene: CCDC66
MFE: -33.192
ENS: 0.777
Length: 112.
Predicted Ligands:
SAM - 13/20
glycine - 3/20
TPP - 2/20
 RS: URS0000C85588_880073
MFE: -38.328
Ligand: SAM
Species: Caldithrix abyssi DSM 13497 SAM riboswitch (S box leader)
 RS: URS0000D7B0BF_1121316
MFE: -24.488
Ligand: SAM
Species: Clostridium grantii DSM 8605 SAM riboswitch (S box leader)
 RS: URS0000AB3E11_403833
MFE: -30.491
Ligand: SAM
Species: Petrotoga mobilis SJ95 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA018600 URS0000C85588_880073 URS0000D7B0BF_1121316 URS0000AB3E11_403833
Length 112. 113. 112. 112.
Similarity - 0.976 0.974 0.974
Ensemble Norm 0.777 - - -
MFE -33.192 -38.328 -24.488 -30.491
Ligands - SAM SAM SAM
Gene CCDC66 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.002 5.001 6.001
Length SE - 1. 0. 0.
Lev Distance - 30. 33. 33.
UBS 8. 8. 8. 9.
BS 0. 0. 0. 0.
ILL 0. 1. 0. 0.
ILR 1. 1. 2. 1.
H 4. 4. 4. 4.
BL 2. 2. 2. 4.
BR 3. 2. 1. 2.
UN 0.062 0.106 0.098 0.089

Sequences

Field Description
UTR seq + 25 aauuggcguagcgcuugcugagcggcggcggcaaccgacguacacaaggggcuugagcguucuguggagagagugcgaggucaggccATGAACTTGGGAGATGGTTTAAAGC
UTR dot + 25 ..(((.(((.((((((…))))).).))).)))((………..))((((((((((((((……)))))))….))))))).((((((……..))))))….
RS 1 seq UUCUUAUCCAGAAAGGUGGAGGGAACAGGCCCUGUGAAGCCUUAGCAACCUUUCCCGUUGAACCGCGGGAAAAGGUGCUAAUUCCUGCCCCAACUUACGGGGAAAGAUAAGAA
RS 1 dot ((((..((((……)))).))))..(((……..)))(((((.(((((((((((……)))))))).))))))))…((.((((…….))))..))…….
RS 2 seq UUCUUAUCAAGAGUGGUGGAGGGACGAGCCCGUUGAAACCCAGCAACAGCUAAUUAUCAUAUAUAAUUAGAAUUGUGCUAAAUCUUGCAGGAUAAAACCUGAGGGAUAAGGA
RS 2 dot …((((((….)))))).((((((….)))…..)))(((.((((((((((((…..))))))))..)))))))..(((((.((((……)))).)))))…..
RS 3 seq UCCUUAUCGAGAGAGGCGGAGGGACUGGCCCGAAGAAGCCCGGCAACCUGCAUAAUUUAACAAAAUUAUGCAAUGGUGCUAAAUCCUGCAGAGAAAUUCUGGGAGAUAAGGA
RS 3 dot (((((.(((…….))))))))..(((……..))).(((.(((((((((((((….))))))))))..))))))..(((.(.((((…..)))).).)))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table