Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA018631 Similarity: 0.986 Similarity: 0.985 Similarity: 0.984
UTR: 5HSAA018631
Gene: CCDC73
MFE: -7.173
ENS: 0.998
Length: 69.
Predicted Ligands:
fluoride - 18/20
Ni/Co - 1/20
cobalamin - 1/20
 RS: URS0000DA2F64_1262585
MFE: -11.754
Ligand: fluoride
Species: Acinetobacter qingfengensis Fluoride riboswitch
 RS: URS0000BE3E72_587
MFE: -12.874
Ligand: fluoride
Species: Providencia rettgeri Fluoride riboswitch
 RS: URS0000C7EF78_1736407
MFE: -15.693
Ligand: fluoride
Species: Frateuria sp. Soil773 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA018631 URS0000DA2F64_1262585 URS0000BE3E72_587 URS0000C7EF78_1736407
Length 69. 69. 69. 71.
Similarity - 0.986 0.985 0.984
Ensemble Norm 0.998 - - -
MFE -7.173 -11.754 -12.874 -15.693
Ligands - fluoride fluoride fluoride
Gene CCDC73 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.054 2.030 2.054
Length SE - 0. 0. 4.
Lev Distance - 18. 20. 17.
UBS 2. 3. 3. 3.
BS 0. 0. 0. 0.
ILL 0. 0. 1. 0.
ILR 0. 0. 0. 0.
H 2. 2. 2. 2.
BL 0. 1. 0. 1.
BR 0. 1. 0. 0.
UN 0.217 0.449 0.391 0.451

Sequences

Field Description
UTR seq + 25 aacaggagcuagaggcgcgcuucgcugaggaaauaaauauuaauATGGAAAGCAACTTCAATACTGAGT
UTR dot + 25 ….(((((………)))))..(((((…………………….)))))………
RS 1 seq GAUCCAUCGGGAAAUGGCAUACUUCCCUAUACAAACCGCCAAUUGUUGGCUAAUGAUGCCUACGUAACC
RS 1 dot ……..(((((………)))))……………..((.(((…….))).))……
RS 2 seq AAACCUUUGGGAGAUGGCAUUCCUCCUUAUAUAAAACCGCCCGUAGAGGCUGAUGAUGCCUACGUUAAC
RS 2 dot ……..(((((………)))))…………..(((..((((…….)))))))…..
RS 3 seq UCGAACCAGGGAGAUGGCAUUCCUCCCGGAACAGAAGUAACCGCCGCAAGGCUAAUGAUGCCUACCAAACG
RS 3 dot …..((.(((((………)))))))……………….((((…….))))……..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table