Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA018632 Similarity: 0.979 Similarity: 0.979 Similarity: 0.979
UTR: 5HSAA018632
Gene: CCDC73_0
MFE: -9.889
ENS: 0.996
Length: 83.
Predicted Ligands:
cyclic-di-GMP - 9/20
SAM - 3/20
zmp-ztp - 3/20
 RS: URS0000ABD5F0_508767
MFE: -17.360
Ligand: cyclic-di-GMP
Species: Clostridium botulinum E3 str. Alaska E43 Cyclic di-GMP-II riboswitch
 RS: URS0000AB3E9C_508765
MFE: -17.260
Ligand: cyclic-di-GMP
Species: Clostridium botulinum B str. Eklund 17B Cyclic di-GMP-II riboswitch
 RS: URS0000BF1C3B_1454004
MFE: -20.121
Ligand: SAM
Species: Candidatus Accumulibacter sp. BA-93 SAM riboswitch (alpha-proteobacteria)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA018632 URS0000ABD5F0_508767 URS0000AB3E9C_508765 URS0000BF1C3B_1454004
Length 83. 84. 84. 82.
Similarity - 0.979 0.979 0.979
Ensemble Norm 0.996 - - -
MFE -9.889 -17.360 -17.260 -20.121
Ligands - cyclic-di-GMP cyclic-di-GMP SAM
Gene CCDC73 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.024 4.024 19.
Length SE - 1. 1. 1.
Lev Distance - 26. 26. 21.
UBS 5. 5. 5. 3.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 1. 1. 1. 2.
H 2. 2. 2. 1.
BL 3. 1. 1. 0.
BR 2. 2. 2. 0.
UN 0.060 0.214 0.214 0.049

Sequences

Field Description
UTR seq + 25 gaaccggaagggccaacaggagcuagaggcgcgcuucgcugaggaaauaaauauuaauATGGAAAGCAACTTCAATACTGAGT
UTR dot + 25 ….((((.(.(((………….))).)..))))((.((…………………………….)).)).
RS 1 seq UAUAAAGUUGGAGAUUAUGAAUAGUUCUCUUUAUUUGGGCACCUUGAGAACUAGGAAUCAGUGGUGCACCCGGCCAACAAAUUA
RS 1 dot ….((((.(((((………..)))))..))))(((((((((((……….)))).))))).))…………..
RS 2 seq UAUAAAGUUGGAGAUUGUGAAUAGUUCUCUUUAUUUGGGCACCUUGAGAACUAGGAGUCAGUGGUGCACCCGGCCAACAAAUUA
RS 2 dot ….((((.(((((………..)))))..))))(((((((((((……….)))).))))).))…………..
RS 3 seq UGCCGGGUUCGCGCCGAUUUGACGUAAACAGAUUGCGGGCGCGUUAAAAAUACCGCUAAAGCGAAGCCAGAUCAGAACCCGU
RS 3 dot …((((((((((((((((((…….))))))…)))))…………………………..))))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table