Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA018764 Similarity: 0.979 Similarity: 0.978 Similarity: 0.977
UTR: 5HSAA018764
Gene: CCDC91
MFE: -22.676
ENS: 0.775
Length: 114.
Predicted Ligands:
TPP - 17/20
guanidine - 2/20
zmp-ztp - 1/20
 RS: URS0000C6E42F_930089
MFE: -32.961
Ligand: TPP
Species: Bipolaris zeicola 26-R-13 TPP riboswitch (THI element)
 RS: URS0000D98DC1_303698
MFE: -27.677
Ligand: TPP
Species: Penicillium steckii TPP riboswitch (THI element)
 RS: URS0000D7C62E_1797181
MFE: -40.676
Ligand: TPP
Species: Acidobacteria bacterium RIFCSPLOWO2_02_FULL_64_15 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA018764 URS0000C6E42F_930089 URS0000D98DC1_303698 URS0000D7C62E_1797181
Length 114. 114. 114. 115.
Similarity - 0.979 0.978 0.977
Ensemble Norm 0.775 - - -
MFE -22.676 -32.961 -27.677 -40.676
Ligands - TPP TPP TPP
Gene CCDC91 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 16.004 2. 4.013
Length SE - 0. 0. 1.
Lev Distance - 23. 29. 28.
UBS 7. 8. 7. 7.
BS 0. 0. 0. 0.
ILL 1. 0. 1. 3.
ILR 3. 2. 2. 3.
H 2. 2. 3. 2.
BL 1. 4. 1. 1.
BR 2. 4. 2. 2.
UN 0.184 0.123 0.175 0.070

Sequences

Field Description
UTR seq + 25 gugggaaaggauuguuuuccuguaaugaaguccaucuuguauuacugagucaaggaaacuauaaucaacauuugggugccacuugaagaATGGATGATGATGATTTTGGTGGTT
UTR dot + 25 ………(((((((((((((((((((((…..))).))))))…….))))))..))))))………..((((((.(((..((……..))..))).)))))).
RS 1 seq AAUGCAUGAGACCGGUGUUCGCUGUUGUUUCCUUUGUGAACGGCAGCGAUCUGAGAUAUACGGUCUGAACUUGAUCAGGUUAAAGCCUGCGAAAGGACUCAUGCUUUGCUCCCU
RS 1 dot ……(.((((((((((((((((((((((…….))))))))))))……)))).)))))).)……..(((.((((((.((.(……).)).))))))…)))
RS 2 seq AGAACGCAUGACGGGUGUUCGAAGCCUCACUCGAAAGAGUCGCUUUGUUCUGAGAUAUUACCGUUAAAACUUGAUCUGGACAAUACCAGCGAAAGGACAUGCCUGUUCUAUCCU
RS 2 dot ……..(((((((((((((((((…((((….)))).))))))……)))))..))))))………((((……)))).((.((((((….)))))).))..
RS 3 seq CGUAGCCGCCAGGGGUAUCCCUCAUCCGAGGCCGAGCGUCUCGUAGGGAUUGAGAGCAGACCCUUGGAACCUGAUCCGGUUGAAACCGGCGAAGGGAGAGCGGGAUGUCAGCCUU
RS 3 dot ..(((…((((((((((((((….((((((…..)))))).))))))………))))))))…)))….((((((..((.((………)).))…))))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table